Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTG

Taxonomy: NA

common ontology terms
term enrichment score
TermScore
atlantic ocean0.307692
white abalone0.285714
portuguese republic0.285714
haliotis sorenseni0.285714
zebra fish0.266667
ocean water0.258065
danio rerio0.250000
depth 20m0.222222
commonwealth of massachusetts0.210526
eunicella labiata0.210526
hawaii0.210526
coastal water0.210526
gorgonian coral0.210526
coral reef0.190476
age 21 days0.190476
state of oregon0.173913
juvenile organism0.173913
coral0.173913
intestine0.166667
surface water0.148148
sea water0.148148
water0.135593
fish0.121212
bobtail squid0.117647
shenzhen city prefecture0.117647
LOWER IN marine water body0.117647
euprymna scolopes0.117647
egg jelly0.117647
LOWER IN saline water0.117647
mediterranean sea0.117647
chitin beads0.117647
depth 2000-3000m0.117647
shell0.117647
LOWER IN shell gland0.117647
LOWER IN depth 0m0.111111
pacific white shrimp0.111111
aquarium0.111111
litopenaeus vannamei0.111111
marine water body0.111111
saline water0.105263
egg0.105263
LOWER IN sea water0.105263
late timepoints0.090909
state of california0.086957
research facility0.081159
larval stage0.076923
LOWER IN adult0.064516
united states of america0.059055
digestive system0.050000
china0.022727
feces0.010753
Fraction of dbbact annotations with this term covered by the query
TermScore
hawaii0.500000
bobtail squid0.500000
shenzhen city prefecture0.500000
mediterranean sea0.500000
euprymna scolopes0.500000
commonwealth of massachusetts0.500000
egg jelly0.500000
white abalone0.500000
LOWER IN saline water0.500000
eunicella labiata0.500000
LOWER IN marine water body0.500000
chitin beads0.500000
depth 2000-3000m0.500000
portuguese republic0.500000
shell0.500000
coastal water0.500000
gorgonian coral0.500000
LOWER IN shell gland0.500000
haliotis sorenseni0.500000
zebra fish0.400000
LOWER IN depth 0m0.333333
danio rerio0.333333
age 21 days0.333333
pacific white shrimp0.333333
coral reef0.333333
aquarium0.333333
litopenaeus vannamei0.333333
marine water body0.333333
atlantic ocean0.285714
state of oregon0.250000
saline water0.250000
depth 20m0.250000
ocean water0.250000
egg0.250000
juvenile organism0.250000
LOWER IN sea water0.250000
coral0.250000
surface water0.166667
sea water0.166667
intestine0.142857
late timepoints0.142857
fish0.111111
larval stage0.090909
water0.090909
LOWER IN adult0.062500
state of california0.055556
research facility0.044444
digestive system0.040000
united states of america0.031056
china0.013699
feces0.005848
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.600000
research facility0.466667
atlantic ocean0.333333
water0.266667
ocean water0.266667
intestine0.200000
depth 20m0.200000
white abalone0.200000
zebra fish0.200000
portuguese republic0.200000
danio rerio0.200000
state of california0.200000
haliotis sorenseni0.200000
surface water0.133333
state of oregon0.133333
commonwealth of massachusetts0.133333
sea water0.133333
eunicella labiata0.133333
hawaii0.133333
fish0.133333
juvenile organism0.133333
coral reef0.133333
coral0.133333
age 21 days0.133333
coastal water0.133333
gorgonian coral0.133333
larval stage0.066667
digestive system0.066667
bobtail squid0.066667
shenzhen city prefecture0.066667
LOWER IN marine water body0.066667
euprymna scolopes0.066667
feces0.066667
saline water0.066667
LOWER IN depth 0m0.066667
china0.066667
egg jelly0.066667
LOWER IN saline water0.066667
early time points0.066667
egg0.066667
mediterranean sea0.066667
pacific white shrimp0.066667
late timepoints0.066667
LOWER IN sea water0.066667
chitin beads0.066667
depth 2000-3000m0.066667
hydroides elegans0.066667
LOWER IN adult0.066667
LOWER IN late time points0.066667
aquarium0.066667
shell0.066667
tubeworm0.066667
tubeworm tube0.066667
LOWER IN shell gland0.066667
litopenaeus vannamei0.066667
marine water body0.066667
pearl harbor0.066667
Exp. ID User ID Description Date Sequences
280amnon high in coral reef eunicella labiata gorgonian coral coral compared to marine water body saline water sea water in atlantic ocean portuguese republic depth 20m 2018-01-251 / 19
437amnonhighfreq united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-261 / 20
93amnon high in egg egg jelly compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-121 / 53
437amnoncommon united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-261 / 54
461amnonlate colonizers in chitin beads incubated in ocean water (other united states of america, water, surface water, coastal water, ocean water, atlantic ocean, commonwealth of massachusetts, late timepoints, chitin beads)2019-01-121 / 120
280amnoncommon coral reef, atlantic ocean, portuguese republic, depth 20m, eunicella labiata, gorgonian coral, coral2018-01-251 / 128
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-101 / 128
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to late time points depth 0m in water ocean water mediterranean sea depth 2000-3000m )2019-03-051 / 132
85amnoncommon china, digestive system, ocean water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp2017-03-061 / 147
280amnoncommon marine water body, saline water, sea water, atlantic ocean, portuguese republic, depth 20m2018-01-251 / 259
461amnoncommon united states of america, water, surface water, coastal water, ocean water, atlantic ocean, commonwealth of massachusetts2019-01-121 / 322
308amnoncommon feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-301 / 609
308amnoncommon united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-301 / 632
483amnoncommon united states of america, research facility, tubeworm tube, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-131 / 683
308amnoncommon in aquarium water with white abalone (common united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-301 / 727

Problems / suggestions? Please email info AT dbbact DOT org