Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTG

Taxonomy: NA

common ontology terms
term enrichment score
TermScore
atlantic ocean0.285714
portuguese republic0.285714
haliotis sorenseni0.285714
white abalone0.285714
zebra fish0.266667
danio rerio0.250000
sea water0.240964
depth 20m0.222222
eunicella labiata0.210526
gorgonian coral0.210526
hawaii0.210526
coastal water0.210526
coral reef0.190476
age 21 days0.190476
commonwealth of massachusetts0.190476
juvenile organism0.173913
coral0.160000
state of oregon0.160000
intestine0.148148
surface water0.129032
LOWER IN marine water body0.117647
bobtail squid0.117647
euprymna scolopes0.117647
egg jelly0.117647
LOWER IN shell gland0.117647
chitin beads0.117647
shenzhen city prefecture0.117647
shell0.117647
pearl harbor0.117647
hydroides elegans0.117647
tubeworm0.117647
tubeworm tube0.117647
LOWER IN saline water0.111111
depth 2000-3000m0.111111
marine water body0.111111
aquarium0.111111
fish0.108108
mediterranean sea0.105263
LOWER IN depth 0m0.105263
LOWER IN late time points0.105263
early time points0.105263
litopenaeus vannamei0.105263
pacific white shrimp0.105263
water0.104803
shelled egg0.100000
LOWER IN sea water0.090909
late timepoints0.090909
saline water0.090909
state of california0.083333
research facility0.075778
larval stage0.071429
LOWER IN adult0.062500
united states of america0.051458
digestive system0.047619
china0.019608
feces0.009174
Fraction of dbbact annotations with this term covered by the query
TermScore
portuguese republic0.500000
eunicella labiata0.500000
gorgonian coral0.500000
LOWER IN marine water body0.500000
hawaii0.500000
bobtail squid0.500000
euprymna scolopes0.500000
egg jelly0.500000
LOWER IN shell gland0.500000
coastal water0.500000
chitin beads0.500000
shenzhen city prefecture0.500000
haliotis sorenseni0.500000
white abalone0.500000
shell0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
tubeworm tube0.500000
zebra fish0.400000
coral reef0.333333
LOWER IN saline water0.333333
danio rerio0.333333
age 21 days0.333333
commonwealth of massachusetts0.333333
depth 2000-3000m0.333333
marine water body0.333333
aquarium0.333333
atlantic ocean0.250000
depth 20m0.250000
juvenile organism0.250000
mediterranean sea0.250000
LOWER IN depth 0m0.250000
LOWER IN late time points0.250000
early time points0.250000
litopenaeus vannamei0.250000
pacific white shrimp0.250000
coral0.200000
state of oregon0.200000
shelled egg0.200000
sea water0.172414
LOWER IN sea water0.142857
late timepoints0.142857
saline water0.142857
surface water0.125000
intestine0.117647
fish0.090909
larval stage0.076923
water0.065217
LOWER IN adult0.058824
state of california0.052632
research facility0.041237
digestive system0.037037
united states of america0.026882
china0.011494
feces0.004926
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.600000
research facility0.466667
sea water0.400000
atlantic ocean0.333333
water0.266667
depth 20m0.200000
portuguese republic0.200000
zebra fish0.200000
danio rerio0.200000
intestine0.200000
state of california0.200000
haliotis sorenseni0.200000
white abalone0.200000
eunicella labiata0.133333
coral reef0.133333
gorgonian coral0.133333
coral0.133333
fish0.133333
juvenile organism0.133333
age 21 days0.133333
state of oregon0.133333
hawaii0.133333
surface water0.133333
coastal water0.133333
commonwealth of massachusetts0.133333
LOWER IN saline water0.066667
LOWER IN sea water0.066667
LOWER IN marine water body0.066667
bobtail squid0.066667
euprymna scolopes0.066667
egg jelly0.066667
LOWER IN shell gland0.066667
shelled egg0.066667
chitin beads0.066667
late timepoints0.066667
larval stage0.066667
LOWER IN adult0.066667
mediterranean sea0.066667
LOWER IN depth 0m0.066667
LOWER IN late time points0.066667
depth 2000-3000m0.066667
early time points0.066667
litopenaeus vannamei0.066667
pacific white shrimp0.066667
shenzhen city prefecture0.066667
digestive system0.066667
china0.066667
saline water0.066667
marine water body0.066667
feces0.066667
shell0.066667
pearl harbor0.066667
hydroides elegans0.066667
tubeworm0.066667
tubeworm tube0.066667
aquarium0.066667
Exp. ID User ID Description Date Region Flag Sequences
280amnon high in eunicella labiata coral reef gorgonian coral coral compared to saline water sea water marine water body in atlantic ocean depth 20m portuguese republic 2018-01-25v4No1 / 19
437amnonhighfreq fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 20
93amnon high in egg jelly shelled egg compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 53
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 54
461amnonlate colonizers in chitin beads incubated in ocean water (other water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, chitin beads, late timepoints, sea water)2019-01-12v4No1 / 120
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 128
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to depth 0m late time points in water mediterranean sea depth 2000-3000m sea water )2019-03-05v4No1 / 132
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth 20m, portuguese republic2018-01-25v4No1 / 259
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-30v4No1 / 609
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-30v4No1 / 632
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-13v4No1 / 683
308amnoncommon in aquarium water with white abalone (common united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-30v4No1 / 727

Problems / suggestions? Please email info AT dbbact DOT org