Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTG
common ontology terms
term enrichment score
TermScore
atlantic ocean0.222222
mangrove swamp0.222222
LOWER IN saline water0.200000
portuguese republic0.193548
san diego0.193548
haliotis sorenseni0.193548
white abalone0.193548
kandelia candel0.193548
sea water0.189274
zebra fish0.184615
LOWER IN sea water0.176471
danio rerio0.176471
mangrove0.176471
marine sediment0.171429
depth 20m0.162162
depth 0-20cm0.153846
fish0.150943
eunicella labiata0.137931
gorgonian coral0.137931
hawaii0.137931
coastal water0.137931
chub mackerel0.137931
scomber japonicus0.137931
dongzhaigang national nature reserve0.137931
leizhou nature reserve0.137931
aquarium0.133333
coral reef0.129032
age 21 days0.129032
hainan autonomous prefecture0.129032
guangdong province0.129032
coral0.114286
juvenile organism0.114286
commonwealth of massachusetts0.114286
state of oregon0.108108
water0.108108
intestine0.106195
surface water0.088889
pacific ocean0.075949
LOWER IN marine water body0.074074
bobtail squid0.074074
euprymna scolopes0.074074
egg jelly0.074074
LOWER IN shell gland0.074074
chitin beads0.074074
romania0.074074
ursu lake0.074074
depth 0-3m0.074074
mixolimnion0.074074
shenzhen city prefecture0.074074
LOWER IN epidermis0.074074
LOWER IN gastrointestinal system0.074074
LOWER IN alimentary part of gastrointestinal system0.074074
shell0.074074
pearl harbor0.074074
hydroides elegans0.074074
tubeworm0.074074
tubeworm tube0.074074
mudflat0.074074
futian national nature reserve0.074074
saline water biofilm0.074074
biofilm0.074074
english channel coastal waters of france0.074074
lake water0.071429
low salinity0.071429
depth 2000-3000m0.071429
marine water body0.071429
spartina alterniflora0.071429
mediterranean sea0.068966
LOWER IN depth 0m0.068966
litopenaeus vannamei0.068966
pacific white shrimp0.068966
gill0.068966
digesta0.068966
fish farm0.068966
shelled egg0.066667
state of california0.065934
LOWER IN late time points0.064516
early time points0.064516
zhejiang province0.064516
late timepoints0.062500
lake0.062500
research facility0.061404
LOWER IN skin0.060606
french republic0.058824
saline water0.057143
LOWER IN water0.052632
larval stage0.051282
LOWER IN adult0.044444
united states of america0.043689
sediment0.040816
digestive system0.037736
china0.032172
soil0.028571
feces0.014337
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN saline water0.600000
portuguese republic0.500000
eunicella labiata0.500000
gorgonian coral0.500000
LOWER IN marine water body0.500000
hawaii0.500000
bobtail squid0.500000
euprymna scolopes0.500000
egg jelly0.500000
LOWER IN shell gland0.500000
coastal water0.500000
chitin beads0.500000
romania0.500000
ursu lake0.500000
depth 0-3m0.500000
mixolimnion0.500000
shenzhen city prefecture0.500000
LOWER IN epidermis0.500000
chub mackerel0.500000
scomber japonicus0.500000
san diego0.500000
haliotis sorenseni0.500000
white abalone0.500000
LOWER IN gastrointestinal system0.500000
LOWER IN alimentary part of gastrointestinal system0.500000
shell0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
tubeworm tube0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
saline water biofilm0.500000
biofilm0.500000
english channel coastal waters of france0.500000
zebra fish0.400000
aquarium0.400000
coral reef0.333333
LOWER IN sea water0.333333
danio rerio0.333333
age 21 days0.333333
lake water0.333333
low salinity0.333333
depth 2000-3000m0.333333
marine water body0.333333
mangrove0.333333
hainan autonomous prefecture0.333333
guangdong province0.333333
spartina alterniflora0.333333
atlantic ocean0.250000
depth 20m0.250000
mediterranean sea0.250000
LOWER IN depth 0m0.250000
litopenaeus vannamei0.250000
pacific white shrimp0.250000
gill0.250000
digesta0.250000
mangrove swamp0.250000
fish farm0.250000
coral0.200000
juvenile organism0.200000
shelled egg0.200000
commonwealth of massachusetts0.200000
state of oregon0.166667
LOWER IN late time points0.166667
early time points0.166667
zhejiang province0.166667
sea water0.156250
fish0.142857
late timepoints0.142857
lake0.142857
marine sediment0.133333
LOWER IN skin0.125000
depth 0-20cm0.125000
french republic0.111111
surface water0.100000
saline water0.100000
intestine0.095238
LOWER IN water0.076923
water0.074074
larval stage0.071429
pacific ocean0.055556
LOWER IN adult0.050000
state of california0.045455
sediment0.041667
digestive system0.035714
research facility0.034483
united states of america0.023256
china0.017241
soil0.015385
feces0.007874
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.360000
research facility0.280000
sea water0.240000
china0.240000
marine sediment0.240000
atlantic ocean0.200000
water0.200000
soil0.200000
mangrove swamp0.200000
depth 0-20cm0.200000
fish0.160000
depth 20m0.120000
portuguese republic0.120000
LOWER IN saline water0.120000
LOWER IN sea water0.120000
zebra fish0.120000
danio rerio0.120000
intestine0.120000
san diego0.120000
pacific ocean0.120000
state of california0.120000
haliotis sorenseni0.120000
white abalone0.120000
mangrove0.120000
kandelia candel0.120000
eunicella labiata0.080000
coral reef0.080000
gorgonian coral0.080000
coral0.080000
juvenile organism0.080000
age 21 days0.080000
state of oregon0.080000
hawaii0.080000
surface water0.080000
coastal water0.080000
commonwealth of massachusetts0.080000
chub mackerel0.080000
scomber japonicus0.080000
feces0.080000
aquarium0.080000
hainan autonomous prefecture0.080000
dongzhaigang national nature reserve0.080000
guangdong province0.080000
leizhou nature reserve0.080000
LOWER IN marine water body0.040000
bobtail squid0.040000
euprymna scolopes0.040000
egg jelly0.040000
LOWER IN shell gland0.040000
shelled egg0.040000
chitin beads0.040000
late timepoints0.040000
larval stage0.040000
LOWER IN adult0.040000
lake0.040000
romania0.040000
ursu lake0.040000
lake water0.040000
depth 0-3m0.040000
mixolimnion0.040000
low salinity0.040000
mediterranean sea0.040000
LOWER IN depth 0m0.040000
LOWER IN late time points0.040000
depth 2000-3000m0.040000
early time points0.040000
litopenaeus vannamei0.040000
pacific white shrimp0.040000
shenzhen city prefecture0.040000
digestive system0.040000
saline water0.040000
marine water body0.040000
LOWER IN epidermis0.040000
LOWER IN skin0.040000
gill0.040000
LOWER IN gastrointestinal system0.040000
LOWER IN alimentary part of gastrointestinal system0.040000
digesta0.040000
shell0.040000
pearl harbor0.040000
hydroides elegans0.040000
tubeworm0.040000
tubeworm tube0.040000
mudflat0.040000
zhejiang province0.040000
futian national nature reserve0.040000
spartina alterniflora0.040000
LOWER IN water0.040000
sediment0.040000
saline water biofilm0.040000
biofilm0.040000
fish farm0.040000
french republic0.040000
english channel coastal waters of france0.040000
Exp. ID User ID Description Date Region Flag Sequences
280amnon high in eunicella labiata coral reef gorgonian coral coral compared to saline water sea water marine water body in atlantic ocean depth 20m portuguese republic 2018-01-25v4No1 / 18
437amnondominant fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 19
93amnon high in egg jelly shelled egg compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 52
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 53
461amnonlate colonizers in chitin beads incubated in ocean water (other water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, chitin beads, late timepoints, sea water)2019-01-12v4No1 / 119
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 127
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 127
577amnoncommon lake, romania, ursu lake, water, lake water, depth 0-3m, mixolimnion, low salinity2020-01-09v3No1 / 129
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to depth 0m late time points in water mediterranean sea depth 2000-3000m sea water )2019-03-05v4No1 / 131
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 146
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth 20m, portuguese republic2018-01-25v4No1 / 258
642amnon high in gill compared to epidermis skin in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 279
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 321
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-30v4No1 / 608
642amnon high in feces digesta compared to gastrointestinal system alimentary part of gastrointestinal system in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 627
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-30v4No1 / 631
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-13v4No1 / 682
308amnoncommon in aquarium water with white abalone (common united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-30v4No1 / 726
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1350
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1421
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1434
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1436
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1522
642amnon high in marine sediment sediment compared to saline water sea water water in san diego pacific ocean 2020-08-28v4No1 / 3216
676amnon high in saline water biofilm biofilm compared to saline water sea water in aquarium fish farm french republic english channel coastal waters of france 2028-02-27v4No1 / 3904

Problems / suggestions? Please email info AT dbbact DOT org