Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTG
common ontology terms
term enrichment score
TermScore
atlantic ocean0.317460
white abalone0.300000
portuguese republic0.300000
haliotis sorenseni0.300000
zebra fish0.279070
danio rerio0.260870
depth 20m0.230769
commonwealth of massachusetts0.222222
eunicella labiata0.222222
hawaii0.222222
coastal water0.222222
gorgonian coral0.222222
age 21 days0.200000
coral reef0.200000
ocean water0.187500
state of oregon0.181818
juvenile organism0.181818
coral0.181818
intestine0.171429
surface water0.153846
sea water0.153846
bobtail squid0.125000
shenzhen city prefecture0.125000
euprymna scolopes0.125000
egg jelly0.125000
LOWER IN saline water0.125000
LOWER IN marine water body0.125000
fish0.125000
chitin beads0.125000
shell0.125000
LOWER IN shell gland0.125000
pacific white shrimp0.117647
aquarium0.117647
litopenaeus vannamei0.117647
marine water body0.117647
saline water0.111111
egg0.111111
LOWER IN sea water0.111111
late timepoints0.095238
water0.094488
state of california0.088235
research facility0.081633
larval stage0.080000
LOWER IN adult0.066667
united states of america0.059250
digestive system0.051282
china0.022989
feces0.010811
Fraction of dbbact annotations with this term covered by the query
TermScore
hawaii0.500000
bobtail squid0.500000
shenzhen city prefecture0.500000
euprymna scolopes0.500000
commonwealth of massachusetts0.500000
egg jelly0.500000
white abalone0.500000
LOWER IN saline water0.500000
eunicella labiata0.500000
LOWER IN marine water body0.500000
chitin beads0.500000
portuguese republic0.500000
shell0.500000
coastal water0.500000
gorgonian coral0.500000
LOWER IN shell gland0.500000
haliotis sorenseni0.500000
zebra fish0.400000
danio rerio0.333333
age 21 days0.333333
pacific white shrimp0.333333
coral reef0.333333
aquarium0.333333
litopenaeus vannamei0.333333
marine water body0.333333
atlantic ocean0.285714
state of oregon0.250000
saline water0.250000
depth 20m0.250000
egg0.250000
juvenile organism0.250000
LOWER IN sea water0.250000
coral0.250000
surface water0.166667
ocean water0.166667
sea water0.166667
intestine0.142857
late timepoints0.142857
fish0.111111
larval stage0.090909
LOWER IN adult0.062500
water0.060606
state of california0.055556
research facility0.044444
digestive system0.040000
united states of america0.031056
china0.013699
feces0.005848
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.642857
research facility0.500000
atlantic ocean0.357143
intestine0.214286
water0.214286
depth 20m0.214286
ocean water0.214286
white abalone0.214286
zebra fish0.214286
portuguese republic0.214286
danio rerio0.214286
state of california0.214286
haliotis sorenseni0.214286
surface water0.142857
state of oregon0.142857
commonwealth of massachusetts0.142857
sea water0.142857
eunicella labiata0.142857
hawaii0.142857
age 21 days0.142857
fish0.142857
juvenile organism0.142857
coral0.142857
coral reef0.142857
coastal water0.142857
gorgonian coral0.142857
larval stage0.071429
digestive system0.071429
bobtail squid0.071429
shenzhen city prefecture0.071429
euprymna scolopes0.071429
feces0.071429
saline water0.071429
china0.071429
egg jelly0.071429
LOWER IN saline water0.071429
egg0.071429
LOWER IN marine water body0.071429
pacific white shrimp0.071429
LOWER IN sea water0.071429
chitin beads0.071429
hydroides elegans0.071429
LOWER IN adult0.071429
aquarium0.071429
shell0.071429
tubeworm0.071429
tubeworm tube0.071429
late timepoints0.071429
LOWER IN shell gland0.071429
litopenaeus vannamei0.071429
marine water body0.071429
pearl harbor0.071429
Exp. ID User ID Description Date Sequences
280amnon high in coral reef eunicella labiata gorgonian coral coral compared to marine water body saline water sea water in atlantic ocean portuguese republic depth 20m 2018-01-251 / 19
437amnonhighfreq united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-261 / 20
93amnon high in egg egg jelly compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-121 / 53
437amnoncommon united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-261 / 54
461amnonlate colonizers in chitin beads incubated in ocean water (other united states of america, water, surface water, coastal water, ocean water, atlantic ocean, commonwealth of massachusetts, late timepoints, chitin beads)2019-01-121 / 120
280amnoncommon coral reef, atlantic ocean, portuguese republic, depth 20m, eunicella labiata, gorgonian coral, coral2018-01-251 / 128
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-101 / 128
85amnoncommon china, digestive system, ocean water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp2017-03-061 / 147
280amnoncommon marine water body, saline water, sea water, atlantic ocean, portuguese republic, depth 20m2018-01-251 / 259
461amnoncommon united states of america, water, surface water, coastal water, ocean water, atlantic ocean, commonwealth of massachusetts2019-01-121 / 322
308amnoncommon feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-301 / 609
308amnoncommon united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-301 / 632
483amnoncommon united states of america, research facility, tubeworm tube, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-131 / 683
308amnoncommon in aquarium water with white abalone (common united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-301 / 727

Problems / suggestions? Please email info AT dbbact DOT org