Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTG
common ontology terms
term enrichment score
TermScore
atlantic ocean0.357143
white abalone0.315789
portuguese republic0.315789
haliotis sorenseni0.315789
zebra fish0.292683
danio rerio0.292683
depth 20m0.272727
eunicella labiata0.235294
gorgonian coral0.235294
ocean water0.214286
coral0.210526
coral reef0.210526
age 21 days0.210526
state of oregon0.190476
juvenile organism0.190476
intestine0.184615
surface water0.173913
sea water0.160000
fish0.137931
bobtail squid0.133333
shenzhen city prefecture0.133333
euprymna scolopes0.133333
egg jelly0.133333
LOWER IN saline water0.133333
LOWER IN marine water body0.133333
shell0.133333
LOWER IN shell gland0.133333
saline water0.125000
hawaii0.125000
pacific white shrimp0.125000
aquarium0.125000
litopenaeus vannamei0.125000
marine water body0.125000
egg0.117647
LOWER IN sea water0.117647
late timepoints0.111111
water0.106195
state of california0.103448
larval stage0.083333
LOWER IN adult0.071429
research facility0.070175
digestive system0.054054
united states of america0.052805
china0.025000
feces0.011628
Fraction of dbbact annotations with this term covered by the query
TermScore
bobtail squid0.500000
shenzhen city prefecture0.500000
euprymna scolopes0.500000
egg jelly0.500000
white abalone0.500000
LOWER IN saline water0.500000
eunicella labiata0.500000
LOWER IN marine water body0.500000
portuguese republic0.500000
shell0.500000
gorgonian coral0.500000
LOWER IN shell gland0.500000
haliotis sorenseni0.500000
zebra fish0.400000
danio rerio0.400000
hawaii0.333333
atlantic ocean0.333333
saline water0.333333
depth 20m0.333333
pacific white shrimp0.333333
coral0.333333
coral reef0.333333
aquarium0.333333
age 21 days0.333333
litopenaeus vannamei0.333333
marine water body0.333333
state of oregon0.250000
egg0.250000
juvenile organism0.250000
LOWER IN sea water0.250000
surface water0.200000
ocean water0.200000
late timepoints0.200000
sea water0.166667
intestine0.153846
fish0.125000
larval stage0.090909
water0.068966
state of california0.066667
LOWER IN adult0.066667
digestive system0.041667
research facility0.037975
united states of america0.027586
china0.014925
feces0.006289
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.615385
research facility0.461538
atlantic ocean0.384615
intestine0.230769
water0.230769
depth 20m0.230769
ocean water0.230769
white abalone0.230769
zebra fish0.230769
danio rerio0.230769
state of california0.230769
portuguese republic0.230769
haliotis sorenseni0.230769
surface water0.153846
state of oregon0.153846
commonwealth of massachusetts0.153846
sea water0.153846
eunicella labiata0.153846
fish0.153846
juvenile organism0.153846
coral0.153846
coral reef0.153846
age 21 days0.153846
coastal water0.153846
gorgonian coral0.153846
larval stage0.076923
digestive system0.076923
bobtail squid0.076923
shenzhen city prefecture0.076923
euprymna scolopes0.076923
feces0.076923
saline water0.076923
china0.076923
egg jelly0.076923
LOWER IN saline water0.076923
egg0.076923
hawaii0.076923
LOWER IN marine water body0.076923
pacific white shrimp0.076923
late timepoints0.076923
LOWER IN sea water0.076923
chitin beads0.076923
LOWER IN adult0.076923
aquarium0.076923
shell0.076923
LOWER IN shell gland0.076923
litopenaeus vannamei0.076923
marine water body0.076923
Exp. ID User ID Description Date Sequences
280amnon high in coral reef eunicella labiata gorgonian coral coral compared to marine water body saline water sea water in atlantic ocean portuguese republic depth 20m 2018-01-251 / 19
437amnonhighfreq united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-261 / 20
93amnon high in egg egg jelly compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-121 / 53
437amnoncommon united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-261 / 54
461amnonlate colonizers in chitin beads incubated in ocean water (other united states of america, water, surface water, coastal water, ocean water, atlantic ocean, commonwealth of massachusetts, late timepoints, chitin beads)2019-01-121 / 120
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-101 / 128
280amnoncommon coral reef, atlantic ocean, portuguese republic, depth 20m, eunicella labiata, gorgonian coral, coral2018-01-251 / 128
85amnoncommon china, digestive system, ocean water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp2017-03-061 / 147
280amnoncommon marine water body, saline water, sea water, atlantic ocean, portuguese republic, depth 20m2018-01-251 / 259
461amnoncommon united states of america, water, surface water, coastal water, ocean water, atlantic ocean, commonwealth of massachusetts2019-01-121 / 322
308amnoncommon feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-301 / 609
308amnoncommon united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-301 / 632
308amnoncommon in aquarium water with white abalone (common united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-301 / 727

Problems / suggestions? Please email info AT dbbact DOT org