Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTG

Taxonomy: NA

common ontology terms
term enrichment score
TermScore
sea water0.214286
mangrove swamp0.208333
atlantic ocean0.198020
LOWER IN saline water0.181818
haliotis sorenseni0.176471
white abalone0.176471
kandelia candel0.176471
zebra fish0.169014
portuguese republic0.162162
danio rerio0.162162
LOWER IN sea water0.157895
surface water0.153846
marine sediment0.151899
depth 20m0.150000
san diego0.150000
mangrove0.150000
fish0.142857
intestine0.133333
depth 0-20cm0.128205
eunicella labiata0.125000
gorgonian coral0.125000
normal weather0.125000
okinawa islands0.125000
coastal water0.125000
scomber japonicus0.125000
chub mackerel0.125000
dongzhaigang national nature reserve0.125000
leizhou nature reserve0.125000
hawaii0.121212
aquarium0.121212
coral reef0.117647
age 21 days0.117647
near shore0.117647
guangdong province0.117647
hainan autonomous prefecture0.111111
coral0.105263
juvenile organism0.100000
state of oregon0.100000
filtered 0.2um0.100000
commonwealth of massachusetts0.095238
water0.078947
japan0.074074
pacific ocean0.073171
LOWER IN marine water body0.066667
LOWER IN tropical storm0.066667
penaeus monodon0.066667
black tiger shrimp0.066667
egg jelly0.066667
LOWER IN shell gland0.066667
bobtail squid0.066667
euprymna scolopes0.066667
chitin beads0.066667
shenzhen city prefecture0.066667
LOWER IN epidermis0.066667
sporobolus pumilus0.066667
saltmeadow cordgrass0.066667
LOWER IN phragmites australis0.066667
LOWER IN common reed0.066667
long island sound0.066667
LOWER IN gastrointestinal system0.066667
LOWER IN alimentary part of gastrointestinal system0.066667
shell0.066667
tubeworm tube0.066667
pearl harbor0.066667
hydroides elegans0.066667
tubeworm0.066667
mudflat0.066667
futian national nature reserve0.066667
saline water biofilm0.066667
english channel coastal waters of france0.066667
marine water body0.064516
saline marsh0.064516
state of connecticut0.064516
LOWER IN depth 0m0.062500
depth 2000-3000m0.062500
litopenaeus vannamei0.062500
pacific white shrimp0.062500
estuary0.062500
spartina alterniflora0.062500
shelled egg0.060606
gill0.060606
depth 0-5cm0.060606
fish farm0.060606
state of california0.060000
thailand0.058824
early time points0.058824
LOWER IN late time points0.058824
mediterranean sea0.058824
digesta0.058824
late timepoints0.057143
zhejiang province0.057143
biofilm0.057143
LOWER IN skin0.054054
topsoil0.054054
research facility0.051948
saline water0.051282
french republic0.051282
autumn0.048780
LOWER IN water0.048780
larval stage0.047619
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN saline water0.600000
eunicella labiata0.500000
gorgonian coral0.500000
LOWER IN marine water body0.500000
normal weather0.500000
LOWER IN tropical storm0.500000
okinawa islands0.500000
penaeus monodon0.500000
black tiger shrimp0.500000
egg jelly0.500000
LOWER IN shell gland0.500000
bobtail squid0.500000
euprymna scolopes0.500000
coastal water0.500000
chitin beads0.500000
shenzhen city prefecture0.500000
LOWER IN epidermis0.500000
scomber japonicus0.500000
chub mackerel0.500000
sporobolus pumilus0.500000
saltmeadow cordgrass0.500000
LOWER IN phragmites australis0.500000
LOWER IN common reed0.500000
long island sound0.500000
haliotis sorenseni0.500000
white abalone0.500000
LOWER IN gastrointestinal system0.500000
LOWER IN alimentary part of gastrointestinal system0.500000
shell0.500000
tubeworm tube0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
saline water biofilm0.500000
english channel coastal waters of france0.500000
zebra fish0.400000
hawaii0.400000
aquarium0.400000
coral reef0.333333
portuguese republic0.333333
danio rerio0.333333
age 21 days0.333333
near shore0.333333
marine water body0.333333
saline marsh0.333333
state of connecticut0.333333
guangdong province0.333333
LOWER IN sea water0.300000
depth 20m0.250000
LOWER IN depth 0m0.250000
depth 2000-3000m0.250000
litopenaeus vannamei0.250000
pacific white shrimp0.250000
san diego0.250000
estuary0.250000
mangrove swamp0.250000
mangrove0.250000
hainan autonomous prefecture0.250000
spartina alterniflora0.250000
atlantic ocean0.222222
coral0.200000
shelled egg0.200000
gill0.200000
depth 0-5cm0.200000
fish farm0.200000
sea water0.171429
juvenile organism0.166667
state of oregon0.166667
surface water0.166667
filtered 0.2um0.166667
thailand0.166667
early time points0.166667
LOWER IN late time points0.166667
mediterranean sea0.166667
digesta0.166667
fish0.142857
commonwealth of massachusetts0.142857
late timepoints0.142857
zhejiang province0.142857
biofilm0.142857
intestine0.125000
marine sediment0.117647
LOWER IN skin0.111111
topsoil0.111111
depth 0-20cm0.100000
saline water0.090909
french republic0.090909
japan0.076923
autumn0.076923
LOWER IN water0.076923
larval stage0.071429
pacific ocean0.055556
water0.054545
summer0.045455
LOWER IN adult0.043478
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.357143
sea water0.285714
research facility0.250000
china0.214286
marine sediment0.214286
atlantic ocean0.178571
mangrove swamp0.178571
soil0.178571
depth 0-20cm0.178571
intestine0.142857
fish0.142857
surface water0.142857
water0.142857
LOWER IN saline water0.107143
LOWER IN sea water0.107143
portuguese republic0.107143
depth 20m0.107143
danio rerio0.107143
zebra fish0.107143
pacific ocean0.107143
san diego0.107143
state of california0.107143
haliotis sorenseni0.107143
white abalone0.107143
mangrove0.107143
kandelia candel0.107143
coral reef0.071429
eunicella labiata0.071429
gorgonian coral0.071429
coral0.071429
juvenile organism0.071429
state of oregon0.071429
age 21 days0.071429
normal weather0.071429
near shore0.071429
filtered 0.2um0.071429
japan0.071429
okinawa islands0.071429
hawaii0.071429
coastal water0.071429
commonwealth of massachusetts0.071429
scomber japonicus0.071429
chub mackerel0.071429
feces0.071429
aquarium0.071429
hainan autonomous prefecture0.071429
dongzhaigang national nature reserve0.071429
guangdong province0.071429
leizhou nature reserve0.071429
LOWER IN marine water body0.035714
LOWER IN tropical storm0.035714
summer0.035714
farm0.035714
thailand0.035714
penaeus monodon0.035714
black tiger shrimp0.035714
egg jelly0.035714
shelled egg0.035714
LOWER IN shell gland0.035714
bobtail squid0.035714
euprymna scolopes0.035714
late timepoints0.035714
chitin beads0.035714
larval stage0.035714
LOWER IN adult0.035714
early time points0.035714
LOWER IN late time points0.035714
LOWER IN depth 0m0.035714
mediterranean sea0.035714
depth 2000-3000m0.035714
digestive system0.035714
litopenaeus vannamei0.035714
shenzhen city prefecture0.035714
pacific white shrimp0.035714
autumn0.035714
marine water body0.035714
saline water0.035714
gill0.035714
LOWER IN skin0.035714
LOWER IN epidermis0.035714
sporobolus pumilus0.035714
saltmeadow cordgrass0.035714
LOWER IN phragmites australis0.035714
LOWER IN common reed0.035714
estuary0.035714
saline marsh0.035714
rhizosphere0.035714
topsoil0.035714
state of connecticut0.035714
depth 0-5cm0.035714
long island sound0.035714
digesta0.035714
LOWER IN gastrointestinal system0.035714
LOWER IN alimentary part of gastrointestinal system0.035714
shell0.035714
tubeworm tube0.035714
pearl harbor0.035714
hydroides elegans0.035714
tubeworm0.035714
mudflat0.035714
Exp. ID User ID Description Date Region Flag Sequences
280amnon high in coral reef eunicella labiata gorgonian coral coral compared to marine water body saline water sea water in atlantic ocean portuguese republic depth 20m 2018-01-25v4No1 / 11
437amnondominant united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 12
807amnon high in normal weather compared to tropical storm in surface water sea water summer near shore filtered 0.2um japan okinawa islands 2021-06-20v3No1 / 16
778amnoncommon farm, intestine, thailand, penaeus monodon, black tiger shrimp2021-04-28v3No1 / 25
93amnon high in egg jelly shelled egg compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 45
437amnoncommon united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 46
461amnonlate colonizers in chitin beads incubated in ocean water (other united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts, late timepoints, chitin beads)2019-01-12v4No1 / 112
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 120
280amnoncommon coral reef, atlantic ocean, portuguese republic, depth 20m, eunicella labiata, gorgonian coral, coral2018-01-25v4No1 / 120
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to late time points depth 0m in water sea water mediterranean sea depth 2000-3000m )2019-03-05v4No1 / 124
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 139
807amnoncommon surface water, sea water, autumn, near shore, filtered 0.2um, japan, okinawa islands, normal weather2021-06-20v3No1 / 240
280amnoncommon marine water body, saline water, sea water, atlantic ocean, portuguese republic, depth 20m2018-01-25v4No1 / 251
642amnon high in gill compared to skin epidermis in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v4No1 / 272
461amnoncommon united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts2019-01-12v4No1 / 314
784amnon high in sporobolus pumilus saltmeadow cordgrass compared to phragmites australis common reed in united states of america estuary saline marsh rhizosphere topsoil state of connecticut depth 0-5cm long island sound 2021-05-16v4No1 / 581
308amnoncommon feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 601
642amnon high in feces digesta compared to gastrointestinal system alimentary part of gastrointestinal system in pacific ocean san diego fish scomber japonicus chub mackerel 2020-08-28v4No1 / 620
308amnoncommon united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 624
483amnoncommon united states of america, research facility, tubeworm tube, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 675
308amnoncommon in aquarium water with white abalone (common united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-30v4No1 / 719
571amnoncommon mangrove swamp, soil, marine sediment, depth 0-20cm, mangrove, china, hainan autonomous prefecture, kandelia candel, dongzhaigang national nature reserve2019-12-16v4No1 / 1343
571amnoncommon mangrove swamp, soil, marine sediment, depth 0-20cm, mudflat, china, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1414
571amnoncommon mangrove swamp, soil, marine sediment, zhejiang province, depth 0-20cm, mangrove, china, kandelia candel, futian national nature reserve2019-12-16v4No1 / 1427
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, guangdong province, depth 0-20cm, china, leizhou nature reserve2019-12-16v4No1 / 1429
571amnoncommon mangrove swamp, soil, marine sediment, guangdong province, depth 0-20cm, mangrove, china, kandelia candel, leizhou nature reserve2019-12-16v4No1 / 1515
642amnon high in sediment marine sediment compared to water saline water sea water in pacific ocean san diego 2020-08-28v4No1 / 3209
676amnon high in biofilm saline water biofilm compared to saline water sea water in fish farm aquarium french republic english channel coastal waters of france 2028-02-27v4No1 / 3897

Problems / suggestions? Please email info AT dbbact DOT org