Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTG
common ontology terms
term enrichment score
TermScore
haliotis sorenseni0.400000
white abalone0.400000
portuguese republic0.400000
depth 20m0.333333
coral0.307692
eunicella labiata0.307692
coral reef0.307692
gorgonian coral0.307692
atlantic ocean0.222222
sea water0.200000
euprymna scolopes0.181818
bobtail squid0.181818
shenzhen city prefecture0.181818
shell0.181818
LOWER IN saline water0.181818
LOWER IN marine water body0.181818
egg jelly0.181818
LOWER IN shell gland0.181818
pacific white shrimp0.166667
litopenaeus vannamei0.166667
marine water body0.166667
hawaii0.166667
aquarium0.166667
saline water0.166667
danio rerio0.153846
zebra fish0.153846
egg0.153846
LOWER IN sea water0.153846
state of california0.111111
ocean water0.105263
larval stage0.100000
intestine0.095238
LOWER IN adult0.086957
digestive system0.060606
research facility0.053691
water0.052632
china0.031250
united states of america0.028470
feces0.012987
Fraction of dbbact annotations with this term covered by the query
TermScore
coral0.500000
euprymna scolopes0.500000
haliotis sorenseni0.500000
LOWER IN saline water0.500000
coral reef0.500000
bobtail squid0.500000
eunicella labiata0.500000
gorgonian coral0.500000
shenzhen city prefecture0.500000
shell0.500000
portuguese republic0.500000
LOWER IN marine water body0.500000
egg jelly0.500000
white abalone0.500000
LOWER IN shell gland0.500000
pacific white shrimp0.333333
litopenaeus vannamei0.333333
marine water body0.333333
hawaii0.333333
aquarium0.333333
depth 20m0.333333
saline water0.333333
zebra fish0.250000
egg0.250000
LOWER IN sea water0.250000
danio rerio0.250000
sea water0.181818
atlantic ocean0.166667
ocean water0.100000
larval stage0.090909
intestine0.083333
LOWER IN adult0.071429
state of california0.066667
digestive system0.041667
water0.034483
research facility0.028571
china0.018182
united states of america0.014706
feces0.006897
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.444444
research facility0.444444
atlantic ocean0.333333
haliotis sorenseni0.333333
white abalone0.333333
portuguese republic0.333333
state of california0.333333
depth 20m0.333333
coral0.222222
eunicella labiata0.222222
coral reef0.222222
gorgonian coral0.222222
sea water0.222222
feces0.111111
pacific white shrimp0.111111
euprymna scolopes0.111111
litopenaeus vannamei0.111111
marine water body0.111111
hawaii0.111111
bobtail squid0.111111
water0.111111
danio rerio0.111111
china0.111111
ocean water0.111111
shenzhen city prefecture0.111111
digestive system0.111111
larval stage0.111111
shell0.111111
zebra fish0.111111
LOWER IN saline water0.111111
aquarium0.111111
egg0.111111
LOWER IN marine water body0.111111
intestine0.111111
egg jelly0.111111
LOWER IN sea water0.111111
saline water0.111111
LOWER IN adult0.111111
LOWER IN shell gland0.111111

Problems / suggestions? Please email info AT dbbact DOT org