Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTG
common ontology terms
term enrichment score
TermScore
atlantic ocean0.227273
mangrove swamp0.227273
portuguese republic0.200000
san diego0.200000
haliotis sorenseni0.200000
white abalone0.200000
kandelia candel0.200000
sea water0.196078
zebra fish0.190476
danio rerio0.181818
mangrove0.181818
marine sediment0.173913
depth 0-20cm0.169492
depth 20m0.166667
fish0.153846
eunicella labiata0.142857
gorgonian coral0.142857
LOWER IN saline water0.142857
hawaii0.142857
coastal water0.142857
chub mackerel0.142857
scomber japonicus0.142857
dongzhaigang national nature reserve0.142857
leizhou nature reserve0.142857
coral reef0.133333
age 21 days0.133333
hainan autonomous prefecture0.133333
guangdong province0.133333
LOWER IN sea water0.125000
coral0.117647
juvenile organism0.117647
state of oregon0.117647
commonwealth of massachusetts0.117647
water0.110803
intestine0.108108
surface water0.090909
LOWER IN marine water body0.076923
bobtail squid0.076923
euprymna scolopes0.076923
egg jelly0.076923
LOWER IN shell gland0.076923
chitin beads0.076923
romania0.076923
ursu lake0.076923
depth 0-3m0.076923
mixolimnion0.076923
shenzhen city prefecture0.076923
LOWER IN epidermis0.076923
LOWER IN gastrointestinal system0.076923
LOWER IN alimentary part of gastrointestinal system0.076923
shell0.076923
pearl harbor0.076923
hydroides elegans0.076923
tubeworm0.076923
tubeworm tube0.076923
mudflat0.076923
futian national nature reserve0.076923
pacific ocean0.076923
lake water0.074074
low salinity0.074074
depth 2000-3000m0.074074
marine water body0.074074
state of california0.074074
spartina alterniflora0.074074
mediterranean sea0.071429
LOWER IN depth 0m0.071429
litopenaeus vannamei0.071429
pacific white shrimp0.071429
gill0.071429
digesta0.071429
aquarium0.071429
shelled egg0.068966
LOWER IN late time points0.068966
early time points0.068966
zhejiang province0.066667
late timepoints0.064516
lake0.064516
research facility0.064147
LOWER IN skin0.062500
saline water0.060606
larval stage0.054054
LOWER IN water0.054054
LOWER IN adult0.047619
united states of america0.044978
sediment0.041667
digestive system0.038462
china0.033613
soil0.029070
feces0.014981
Fraction of dbbact annotations with this term covered by the query
TermScore
portuguese republic0.500000
eunicella labiata0.500000
gorgonian coral0.500000
LOWER IN saline water0.500000
LOWER IN marine water body0.500000
hawaii0.500000
bobtail squid0.500000
euprymna scolopes0.500000
egg jelly0.500000
LOWER IN shell gland0.500000
coastal water0.500000
chitin beads0.500000
romania0.500000
ursu lake0.500000
depth 0-3m0.500000
mixolimnion0.500000
shenzhen city prefecture0.500000
LOWER IN epidermis0.500000
chub mackerel0.500000
scomber japonicus0.500000
san diego0.500000
haliotis sorenseni0.500000
white abalone0.500000
LOWER IN gastrointestinal system0.500000
LOWER IN alimentary part of gastrointestinal system0.500000
shell0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
tubeworm tube0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
zebra fish0.400000
coral reef0.333333
danio rerio0.333333
age 21 days0.333333
lake water0.333333
low salinity0.333333
depth 2000-3000m0.333333
marine water body0.333333
mangrove0.333333
hainan autonomous prefecture0.333333
guangdong province0.333333
spartina alterniflora0.333333
atlantic ocean0.250000
depth 20m0.250000
LOWER IN sea water0.250000
mediterranean sea0.250000
LOWER IN depth 0m0.250000
litopenaeus vannamei0.250000
pacific white shrimp0.250000
gill0.250000
digesta0.250000
aquarium0.250000
mangrove swamp0.250000
coral0.200000
juvenile organism0.200000
state of oregon0.200000
shelled egg0.200000
commonwealth of massachusetts0.200000
LOWER IN late time points0.200000
early time points0.200000
zhejiang province0.166667
sea water0.161290
fish0.142857
late timepoints0.142857
lake0.142857
depth 0-20cm0.142857
marine sediment0.133333
LOWER IN skin0.125000
saline water0.111111
surface water0.100000
intestine0.095238
larval stage0.076923
LOWER IN water0.076923
water0.075472
LOWER IN adult0.055556
pacific ocean0.055556
state of california0.052632
sediment0.041667
research facility0.036036
digestive system0.035714
united states of america0.023923
china0.018018
soil0.015625
feces0.008230
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.375000
research facility0.291667
sea water0.250000
china0.250000
marine sediment0.250000
atlantic ocean0.208333
water0.208333
soil0.208333
mangrove swamp0.208333
depth 0-20cm0.208333
fish0.166667
depth 20m0.125000
portuguese republic0.125000
zebra fish0.125000
danio rerio0.125000
intestine0.125000
san diego0.125000
pacific ocean0.125000
state of california0.125000
haliotis sorenseni0.125000
white abalone0.125000
mangrove0.125000
kandelia candel0.125000
eunicella labiata0.083333
coral reef0.083333
gorgonian coral0.083333
coral0.083333
LOWER IN saline water0.083333
LOWER IN sea water0.083333
juvenile organism0.083333
age 21 days0.083333
state of oregon0.083333
hawaii0.083333
surface water0.083333
coastal water0.083333
commonwealth of massachusetts0.083333
chub mackerel0.083333
scomber japonicus0.083333
feces0.083333
hainan autonomous prefecture0.083333
dongzhaigang national nature reserve0.083333
guangdong province0.083333
leizhou nature reserve0.083333
LOWER IN marine water body0.041667
bobtail squid0.041667
euprymna scolopes0.041667
egg jelly0.041667
LOWER IN shell gland0.041667
shelled egg0.041667
chitin beads0.041667
late timepoints0.041667
larval stage0.041667
LOWER IN adult0.041667
lake0.041667
romania0.041667
ursu lake0.041667
lake water0.041667
depth 0-3m0.041667
mixolimnion0.041667
low salinity0.041667
mediterranean sea0.041667
LOWER IN depth 0m0.041667
LOWER IN late time points0.041667
depth 2000-3000m0.041667
early time points0.041667
litopenaeus vannamei0.041667
pacific white shrimp0.041667
shenzhen city prefecture0.041667
digestive system0.041667
saline water0.041667
marine water body0.041667
LOWER IN epidermis0.041667
LOWER IN skin0.041667
gill0.041667
LOWER IN gastrointestinal system0.041667
LOWER IN alimentary part of gastrointestinal system0.041667
digesta0.041667
shell0.041667
pearl harbor0.041667
hydroides elegans0.041667
tubeworm0.041667
tubeworm tube0.041667
aquarium0.041667
mudflat0.041667
zhejiang province0.041667
futian national nature reserve0.041667
spartina alterniflora0.041667
LOWER IN water0.041667
sediment0.041667
Exp. ID User ID Description Date Region Flag Sequences
280amnon high in eunicella labiata coral reef gorgonian coral coral compared to saline water sea water marine water body in atlantic ocean depth 20m portuguese republic 2018-01-25v4No1 / 18
437amnondominant fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 19
93amnon high in egg jelly shelled egg compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 52
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 53
461amnonlate colonizers in chitin beads incubated in ocean water (other water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, chitin beads, late timepoints, sea water)2019-01-12v4No1 / 119
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 127
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 127
577amnoncommon lake, romania, ursu lake, water, lake water, depth 0-3m, mixolimnion, low salinity2020-01-09v3No1 / 129
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to depth 0m late time points in water mediterranean sea depth 2000-3000m sea water )2019-03-05v4No1 / 131
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 146
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth 20m, portuguese republic2018-01-25v4No1 / 258
642amnon high in gill compared to epidermis skin in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 279
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 321
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-30v4No1 / 608
642amnon high in feces digesta compared to gastrointestinal system alimentary part of gastrointestinal system in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 627
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-30v4No1 / 631
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-13v4No1 / 682
308amnoncommon in aquarium water with white abalone (common united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-30v4No1 / 726
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1350
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1421
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1434
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1436
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1522
642amnon high in marine sediment sediment compared to saline water sea water water in san diego pacific ocean 2020-08-28v4No1 / 3216

Problems / suggestions? Please email info AT dbbact DOT org