Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTG
common ontology terms
term enrichment score
TermScore
mangrove biome0.322581
atlantic ocean0.243902
mangrove swamp0.243902
portuguese republic0.222222
haliotis sorenseni0.222222
white abalone0.222222
kandelia candel0.222222
depth 0-20cm0.217391
sea water0.215054
zebra fish0.210526
danio rerio0.200000
mangrove0.200000
depth 20m0.181818
eunicella labiata0.160000
gorgonian coral0.160000
hawaii0.160000
coastal water0.160000
dongzhaigang national nature reserve0.160000
leizhou nature reserve0.160000
coral reef0.148148
age 21 days0.148148
commonwealth of massachusetts0.148148
hainan autonomous prefecture0.148148
guangdong province0.148148
juvenile organism0.137931
coral0.129032
state of oregon0.129032
water0.121581
intestine0.117647
marine sediment0.109890
surface water0.108108
fish0.088889
LOWER IN marine water body0.086957
bobtail squid0.086957
euprymna scolopes0.086957
egg jelly0.086957
LOWER IN shell gland0.086957
chitin beads0.086957
mixolimnion0.086957
depth 0-3m0.086957
ursu lake0.086957
romania0.086957
shenzhen city prefecture0.086957
shell0.086957
pearl harbor0.086957
hydroides elegans0.086957
tubeworm0.086957
tubeworm tube0.086957
mudflat0.086957
futian national nature reserve0.086957
LOWER IN saline water0.083333
low salinity0.083333
lake water0.083333
depth 2000-3000m0.083333
marine water body0.083333
aquarium0.083333
spartina alterniflora0.083333
mediterranean sea0.080000
LOWER IN depth 0m0.080000
LOWER IN late time points0.080000
early time points0.080000
litopenaeus vannamei0.080000
pacific white shrimp0.080000
zhejiang province0.080000
shelled egg0.076923
state of california0.076923
lake0.074074
LOWER IN sea water0.071429
late timepoints0.071429
research facility0.070796
saline water0.068966
larval stage0.058824
LOWER IN adult0.052632
united states of america0.049342
digestive system0.040816
china0.039216
soil0.034965
feces0.008511
Fraction of dbbact annotations with this term covered by the query
TermScore
portuguese republic0.500000
eunicella labiata0.500000
gorgonian coral0.500000
LOWER IN marine water body0.500000
hawaii0.500000
bobtail squid0.500000
euprymna scolopes0.500000
egg jelly0.500000
LOWER IN shell gland0.500000
coastal water0.500000
chitin beads0.500000
mixolimnion0.500000
depth 0-3m0.500000
ursu lake0.500000
romania0.500000
shenzhen city prefecture0.500000
haliotis sorenseni0.500000
white abalone0.500000
shell0.500000
pearl harbor0.500000
hydroides elegans0.500000
tubeworm0.500000
tubeworm tube0.500000
dongzhaigang national nature reserve0.500000
kandelia candel0.500000
mangrove biome0.500000
mudflat0.500000
futian national nature reserve0.500000
leizhou nature reserve0.500000
zebra fish0.400000
coral reef0.333333
LOWER IN saline water0.333333
danio rerio0.333333
age 21 days0.333333
commonwealth of massachusetts0.333333
low salinity0.333333
lake water0.333333
depth 2000-3000m0.333333
marine water body0.333333
aquarium0.333333
hainan autonomous prefecture0.333333
mangrove0.333333
spartina alterniflora0.333333
guangdong province0.333333
atlantic ocean0.250000
depth 20m0.250000
juvenile organism0.250000
mediterranean sea0.250000
LOWER IN depth 0m0.250000
LOWER IN late time points0.250000
early time points0.250000
litopenaeus vannamei0.250000
pacific white shrimp0.250000
mangrove swamp0.250000
zhejiang province0.250000
coral0.200000
state of oregon0.200000
shelled egg0.200000
depth 0-20cm0.200000
sea water0.172414
lake0.166667
LOWER IN sea water0.142857
late timepoints0.142857
surface water0.125000
saline water0.125000
intestine0.100000
fish0.083333
water0.081633
larval stage0.076923
marine sediment0.071429
LOWER IN adult0.058824
state of california0.052632
research facility0.039604
digestive system0.035714
united states of america0.026178
china0.021053
soil0.018868
feces0.004673
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.428571
research facility0.333333
sea water0.285714
china0.285714
atlantic ocean0.238095
water0.238095
mangrove biome0.238095
depth 0-20cm0.238095
marine sediment0.238095
mangrove swamp0.238095
soil0.238095
depth 20m0.142857
portuguese republic0.142857
zebra fish0.142857
danio rerio0.142857
intestine0.142857
state of california0.142857
haliotis sorenseni0.142857
white abalone0.142857
kandelia candel0.142857
mangrove0.142857
eunicella labiata0.095238
coral reef0.095238
gorgonian coral0.095238
coral0.095238
fish0.095238
juvenile organism0.095238
age 21 days0.095238
state of oregon0.095238
hawaii0.095238
surface water0.095238
coastal water0.095238
commonwealth of massachusetts0.095238
dongzhaigang national nature reserve0.095238
hainan autonomous prefecture0.095238
leizhou nature reserve0.095238
guangdong province0.095238
LOWER IN saline water0.047619
LOWER IN sea water0.047619
LOWER IN marine water body0.047619
bobtail squid0.047619
euprymna scolopes0.047619
egg jelly0.047619
LOWER IN shell gland0.047619
shelled egg0.047619
chitin beads0.047619
late timepoints0.047619
larval stage0.047619
LOWER IN adult0.047619
low salinity0.047619
mixolimnion0.047619
depth 0-3m0.047619
lake water0.047619
ursu lake0.047619
romania0.047619
lake0.047619
mediterranean sea0.047619
LOWER IN depth 0m0.047619
LOWER IN late time points0.047619
depth 2000-3000m0.047619
early time points0.047619
litopenaeus vannamei0.047619
pacific white shrimp0.047619
shenzhen city prefecture0.047619
digestive system0.047619
saline water0.047619
marine water body0.047619
feces0.047619
shell0.047619
pearl harbor0.047619
hydroides elegans0.047619
tubeworm0.047619
tubeworm tube0.047619
aquarium0.047619
mudflat0.047619
futian national nature reserve0.047619
zhejiang province0.047619
spartina alterniflora0.047619
Exp. ID User ID Description Date Region Flag Sequences
280amnon high in eunicella labiata coral reef gorgonian coral coral compared to saline water sea water marine water body in atlantic ocean depth 20m portuguese republic 2018-01-25v4No1 / 19
437amnondominant fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 20
93amnon high in egg jelly shelled egg compared to shell gland in hawaii bobtail squid euprymna scolopes 2017-03-12v4No1 / 53
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 54
461amnonlate colonizers in chitin beads incubated in ocean water (other water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, chitin beads, late timepoints, sea water)2019-01-12v4No1 / 120
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
280amnoncommon atlantic ocean, depth 20m, portuguese republic, eunicella labiata, gorgonian coral, coral, coral reef2018-01-25v4No1 / 128
577amnoncommon low salinity, mixolimnion, depth 0-3m, lake water, water, ursu lake, romania, lake2020-01-09v3No1 / 130
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to depth 0m late time points in water mediterranean sea depth 2000-3000m sea water )2019-03-05v4No1 / 132
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth 20m, portuguese republic2018-01-25v4No1 / 259
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-30v4No1 / 609
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-30v4No1 / 632
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-13v4No1 / 683
308amnoncommon in aquarium water with white abalone (common united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-30v4No1 / 727
571amnoncommon dongzhaigang national nature reserve, hainan autonomous prefecture, kandelia candel, mangrove, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1351
571amnoncommon mudflat, dongzhaigang national nature reserve, hainan autonomous prefecture, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1422
571amnoncommon kandelia candel, mangrove, futian national nature reserve, zhejiang province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1435
571amnoncommon spartina alterniflora, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1437
571amnoncommon kandelia candel, mangrove, leizhou nature reserve, guangdong province, mangrove biome, depth 0-20cm, marine sediment, mangrove swamp, soil, china2019-12-16v4No1 / 1523

Problems / suggestions? Please email info AT dbbact DOT org