Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCTTTGTAAGTCGGGGGTGAAAGCCTGTGGCTCAACCACAGAATTGCCTTCGATACTGCATGGCTTGAGACCGGAAGAGGTTAGTGGAACTGCGAG
common ontology terms
term enrichment score
TermScore
soil0.479811
rhizosphere0.327940
cultivated environment0.233010
china0.200522
triticum aestivum0.177580
desert0.161850
citrus0.127536
zea mays0.121101
mexico0.120603
silt loam0.114286
agricultural feature0.112054
depth (soil) 0-20cm0.111940
wheat0.107463
leaf0.101983
shaanxi province0.099379
loess plateau0.094675
depth (soil) 0-10cm0.093567
united states of america0.085106
orchard0.080925
israel0.080114
state of california0.079646
clay loam0.077922
north china plain0.076433
agave0.076433
guanajuato0.076433
yunwushan national natural grassland protection zone0.076433
ningxia province0.076433
calci-orthic aridisol0.076433
haplic calcisol0.076433
grazing exclusion0.076433
glycine max0.072289
root0.068571
brazil0.065574
leaf surface0.065217
state of new york0.065217
myrtillocactus geometrizans0.064516
opuntia robusta0.064516
cactus0.062500
semi-arid0.062500
ph 60.062500
farm0.060519
ph 6-70.059406
state of tennessee0.058824
ph 7-80.056604
agricultural field0.055300
heilongjiang province0.052980
state of florida0.052632
populus0.052288
wanning city0.052288
vanilla planifolia0.052288
soil from vanilla field0.052288
fusarium oxysporum f. sp. vanillae0.052288
chrysanthemum morifolium ramat.0.052288
chrysanthemum0.052288
nanjing county0.052288
gleysol0.052288
sihong county0.052288
chenwei forest0.052288
poplar plantation0.052288
poplar0.052288
oryza sativa0.051836
ph 6.90.050955
LOWER IN root0.050000
pot expreiment0.049689
ph 7.60.047337
winter0.046332
tree0.043243
LOWER IN rhizosphere0.041667
jiangsu province0.040609
merlot0.039735
grapevine0.039735
ph 6-6.50.039735
rice0.039735
greenhouse soil0.039735
yellow brown soil0.039735
30-60 days0.039735
minas gerais state0.039735
campos rupestres0.039735
coarse-loamy soil0.039735
soil fumigation0.039735
dazomet0.039735
depth 0cm0.039735
low sodicity0.039735
salic solonetz0.039735
da'an station0.039735
songnen plain0.039735
0-9 years of grazing exclusion0.039735
LOWER IN 10 years0.039735
LOWER IN reforestation0.039735
LOWER IN robinia pseudoacacia0.039735
mongolia0.039344
vitis vinifera0.038961
soybean0.038961
black soil0.038961
mollisol0.038961
depth (soil) 0-5cm0.038961
greenhouse0.038961
solanum lycopersicum0.038585
bulk soil0.038585
nanjing city prefecture0.038217
Fraction of dbbact annotations with this term covered by the query
TermScore
cultivated environment0.750000
heilongjiang province0.666667
clay loam0.666667
paddy field soil0.666667
ph 90.666667
LOWER IN depth 20-40cm0.666667
leaf surface0.600000
maryland county0.500000
non-seleniferous0.500000
LOWER IN seleniferous0.500000
vero beach, fl0.500000
immokalee, fl0.500000
ft. pierce, fl0.500000
gainesville, fl0.500000
merlot0.500000
grapevine0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
rice0.500000
tomato0.500000
slit loam soil0.500000
ph 7-90.500000
size < 10um0.500000
clear day0.500000
dust storm0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
arachis hypogaea0.500000
peanut0.500000
negev desert0.500000
LOWER IN heat stressed soil0.500000
grassland0.500000
steppe0.500000
north china plain0.500000
ph>80.500000
ph>7, ph<80.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
desert0.500000
depth 1cm0.500000
soil crust0.500000
non mature crust0.500000
LOWER IN mature crust0.500000
moist tropical forest0.500000
ph>4.50.500000
LOWER IN ph&lt;4.50.500000
savanna0.500000
agave0.500000
agave deserti0.500000
agave salmiana0.500000
guanajuato0.500000
agave tequiliana0.500000
LOWER IN agave0.500000
kuwait0.500000
LOWER IN planted soil0.500000
mine tailing0.500000
alkaline mine tailing0.500000
zone 2,30.500000
LOWER IN zone 10.500000
pseudomyrmex spinicola0.500000
red soil0.500000
organic farming0.500000
greenhouse soil0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
continuous cropping0.500000
age 10 years0.500000
LOWER IN detph 30-75cm0.500000
LOWER IN silt clay loam0.500000
populus0.500000
30-60 days0.500000
LOWER IN 0-2 days0.500000
unshaded0.500000
sunlight0.500000
LOWER IN shaded0.500000
heteromeles arbutifolia0.500000
ceanothus jepsonii0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment 0.500000
stover ammendment soil0.500000
day 120.500000
LOWER IN day 10.500000
stover amended soil0.500000
amended with biochar0.500000
triticum aestivum l. cv., xiaoyan no. 220.500000
silty clay0.500000
urea enriched soil0.500000
campinas0.500000
LOWER IN stem surface0.500000
LOWER IN upper stem0.500000
exosphere0.500000
citrullus lanatus0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.662069
china0.441379
rhizosphere0.275862
united states of america0.200000
cultivated environment0.137931
triticum aestivum0.110345
depth (soil) 0-20cm0.103448
desert0.096552
mexico0.082759
citrus0.075862
agricultural feature0.075862
zea mays0.075862
silt loam0.068966
leaf0.062069
wheat0.062069
state of california0.062069
depth (soil) 0-10cm0.055172
loess plateau0.055172
shaanxi province0.055172
israel0.048276
orchard0.048276
farm0.048276
root0.041379
state of new york0.041379
glycine max0.041379
north china plain0.041379
winter0.041379
agave0.041379
guanajuato0.041379
brazil0.041379
clay loam0.041379
ph 6-70.041379
yunwushan national natural grassland protection zone0.041379
ningxia province0.041379
calci-orthic aridisol0.041379
haplic calcisol0.041379
grazing exclusion0.041379
agricultural field0.041379
control0.034483
state of florida0.034483
myrtillocactus geometrizans0.034483
opuntia robusta0.034483
cactus0.034483
semi-arid0.034483
ph 60.034483
homo sapiens0.034483
ph 7-80.034483
leaf surface0.034483
state of tennessee0.034483
LOWER IN root0.027586
LOWER IN rhizosphere0.027586
oryza sativa0.027586
skin0.027586
heilongjiang province0.027586
populus0.027586
tree0.027586
ph 7.60.027586
wanning city0.027586
pot expreiment0.027586
vanilla planifolia0.027586
soil from vanilla field0.027586
fusarium oxysporum f. sp. vanillae0.027586
ph 6.90.027586
chrysanthemum morifolium ramat.0.027586
chrysanthemum0.027586
nanjing county0.027586
gleysol0.027586
jiangsu province0.027586
sihong county0.027586
chenwei forest0.027586
poplar plantation0.027586
poplar0.027586
woodland area0.020690
vitis vinifera0.020690
merlot0.020690
grapevine0.020690
ph 6-6.50.020690
rice0.020690
solanum lycopersicum0.020690
bulk soil0.020690
australia0.020690
research facility0.020690
soybean0.020690
mongolia0.020690
black soil0.020690
mollisol0.020690
greenhouse soil0.020690
yellow brown soil0.020690
nanjing city prefecture0.020690
feces0.020690
bos taurus0.020690
cow0.020690
state of georgia0.020690
late timepoints0.020690
30-60 days0.020690
minas gerais state0.020690
campos rupestres0.020690
depth (soil) 0-5cm0.020690
coarse-loamy soil0.020690
greenhouse0.020690
Exp. ID User ID Description Date Region Flag Sequences
360amnoncommon desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
466amnonlower in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in unshaded sunlight compared to shaded in feces bos taurus cow farm united states of america state of georgia late timepoints 30-60 days )2019-01-14v4No1 / 112
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 196
375amnonlower in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in control compared to rhizosphere planted soil in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 200
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
129amnon high in soil compared to rhizosphere in ph 6-6.5 mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid 2017-04-15v4No1 / 221
466amnoncommon in cow feces left in field for 30-60 days (common feces, bos taurus, cow, farm, united states of america, state of georgia, late timepoints, 30-60 days)2019-01-14v4No1 / 221
824sheryoHigher in soil at 0-10cm depth after 0-9 years compared to after 27-35 years of grazing exclusion, Ningxia china ( high in 0-9 years of grazing exclusion compared to 27-35 years of grazing exclusion in depth (soil) 0-10cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 230
279amnoncommon grassland, steppe, mongolia, soil, china2018-01-24v4No1 / 235
602sheryohigher in rhizoshere of tomato plant roots planted in potting mix amended with biochar ( high in amended with biochar compared to unamended in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 270
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
615amnon high in soil compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 306
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth (soil) 0-20cm compared to depth 20-40cm in ph 6-7 clay loam gleysol china jiangsu province sihong county chenwei forest soil poplar plantation poplar )2021-08-25v4No1 / 312
615amnon high in leaf surface leaf compared to stem surface upper stem stem in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 321
402amnon high in zone 2,3 compared to zone 1 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 322
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
360amnoncommon desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 432
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
792amnoncommon depth (soil) 20-60cm, haloxylon ammodendron, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 443
298amnonhigher in non-mature soil crust ( high in non mature crust compared to mature crust in soil desert united states of america state of utah depth 1cm soil crust )2018-02-20v4No1 / 480
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 490
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 567
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
444amnonhigher in continuously cropped strawberry soil ( high in continuous cropping age 5 years age 10 years compared to age 1 year in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 602
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
466amnonhigher in cow feces left in field for 30-60 days compared to initial feces ( high in late timepoints 30-60 days compared to early timepoints 0-2 days in feces bos taurus cow farm united states of america state of georgia )2019-01-14v4No1 / 662
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
791sheryoHigher at 0cm depth compared to 80cm depth in low saline low sodicity soil in China ( high in depth (soil) 0-20cm depth 0cm compared to depth (soil) 80cm in ph 9 low salinity low sodicity soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 748
271amnon high in rhizosphere glycine max soybean compared to soil in depth (soil) 0-20cm china 2018-01-09v4No1 / 750
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common depth 40-50cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 790
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 807
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common depth 30-4cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 844
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
769sheryocommon in conventional tillage wheat field in northern israel (common conventional tillage, bulk soil, soil, vertisol, israel, northen israel, triticum aestivum)2021-04-18v4No1 / 861
769sheryocommon in no tillage wheat field in northern israel (common bulk soil, soil, vertisol, israel, northen israel, no tillage, triticum aestivum)2021-04-18v4No1 / 871
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 875
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
206amnoncommon in dust storm air from israel particles <10um size (common israel, air, size < 10um, dust, dust storm)2017-10-04v4No1 / 902
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, fusarium oxysporum f. sp. chrysanthemi, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 922
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in ph 8.5 low sodicity low salinity compared to ph 10.5 high sodicity high salinity in depth (soil) 0-20cm depth 0cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 932
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
675sheryoCommon in watermelon rhizosphere soil (common co culture with wheat (triticum aestivum l.), un-inoculated, ph 7, citrullus lanatus, rhizosphere, china)2028-02-22v4No1 / 980
360amnon high in soil compared to agave rhizosphere in desert mexico state of california 2018-08-21v4No1 / 992
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common depth (soil) 0-20cm, ph 8.5, depth 0cm, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 1035
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1038
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1069
263amnoncommon in desert soil irrigated daily in lab (common soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 1076
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common dazomet, soil fumigation, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county, bio-organic fertilizer, compost biofilter, paenibacillus polymyxa, paenibacillus, compost soil, pig manure, conventional tillage, deep plough)2021-04-18v4No1 / 1109
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
420amnoncommon in soil of vegetables in organic field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common china, rhizosphere, citrullus lanatus, co culture with wheat (triticum aestivum l.), ph 7, inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
420amnoncommon in soil of vegetables in organic plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 1294
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1315
783sheryocommon in desert soil in mongolia without water addition treatment (common no water addition, ambient precipitation, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1324
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1397
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
783sheryocommon in desert soil in mongolia under water addition treatment (common 100% above ambient precipitation, water addition, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1442
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1643
462amnon high in depth (soil) 0-30 cm depth (soil) 0-20cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common trichoderma guizhouense njau 4742, fungal enriched bio-fertilizer, fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1661
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1682
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common organic fertilizer- chicken manure compost, ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1765
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 1893
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org