Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGCAGGCGGCTATCCAAGTCAGTGGTGAAAGCCCGGAGCTCAACTCCGGAACTGCCATTGAAACTGTTTAGCTTGAGGACGAGAGAGGTGAGTGGAATTCCCAG
common ontology terms
term enrichment score
TermScore
soil0.419991
rhizosphere0.302570
china0.141342
depth (soil) 0-10cm0.136752
united states of america0.115756
canada0.115108
root0.113208
bog lake0.099010
state of wisconsin0.090090
ph 60.090000
cannabis sativa0.090000
wheat0.088020
freshwater lake0.086207
forest ecosystem0.086124
state of idaho0.086124
depth (soil) 0-20cm0.086022
water0.081958
fresh water0.076271
farm0.075949
triticum aestivum0.075710
state of new york0.074844
agricultural feature0.073469
topsoil0.073394
kellogg biological station0.071429
mesic type hapludalf0.071429
kalamazoo loam0.071429
skin0.067682
river0.066667
germany0.064171
woodland area0.063492
north china plain0.061856
permafrost0.061856
hypolimnion0.061856
robinia pseudoacacia0.061856
reforestation0.061856
shaanxi province0.061856
loess plateau0.060000
state of california0.057143
winter0.056338
state of michigan0.055556
silt loam0.055046
coarse-loamy soil0.052083
yunwushan national natural grassland protection zone0.052083
ningxia province0.052083
calci-orthic aridisol0.052083
haplic calcisol0.052083
grazing exclusion0.052083
depth (soil) 0-5cm0.050761
glycine max0.050125
depth (water) 1m0.049505
mississippi river0.049505
depth 5cm0.042403
peatland0.042105
peat soil0.042105
merlot0.042105
grapevine0.042105
downstream0.042105
boechera stricta0.042105
svalbard archipelago0.042105
day 820.042105
epilimnion0.042105
ph 4.5-50.042105
dimictic lake0.042105
meromictic lake0.042105
panicum virgatum0.042105
solanum lycopersicum0.041812
vitis vinifera0.041237
LOWER IN root0.040609
cultivated environment0.040404
kingdom of norway0.037383
brassicaceae0.036697
brazil0.036364
united kingdom0.034783
fen0.032172
ph<60.032172
cambridgeshire0.031915
lower mississippi river0.031915
minas gerais state0.031915
campos rupestres0.031915
root endosphere0.031915
early flowering stage0.031915
"trout bog" lake0.031915
nanjing county0.031915
chrysanthemum0.031915
chrysanthemum morifolium ramat.0.031915
soil fumigation0.031915
dazomet0.031915
mesocosm0.031915
depth 0cm0.031915
low sodicity0.031915
salic solonetz0.031915
da'an station0.031915
songnen plain0.031915
olympic national park0.031915
restored prairie0.031915
20 years0.031915
tundra0.031662
province of quebec0.031414
newt0.031414
heilongjiang province0.031414
Fraction of dbbact annotations with this term covered by the query
TermScore
fen0.666667
ph<60.666667
LOWER IN ph&gt;60.666667
potting mix0.666667
depth 5cm0.600000
field soil0.500000
LOWER IN sewage0.500000
non-seleniferous0.500000
LOWER IN seleniferous0.500000
peatland0.500000
peat soil0.500000
temperate grassland biome0.500000
flooded grassland biome0.500000
immokalee, fl0.500000
gainesville, fl0.500000
anaxyrus americanus0.500000
american toad0.500000
central park0.500000
merlot0.500000
grapevine0.500000
water treatment plant0.500000
LOWER IN distribution system0.500000
winter barley0.500000
tomato0.500000
slit loam soil0.500000
ph 60.500000
slit loam0.500000
pinus sibirica0.500000
pine forest0.500000
lichen0.500000
moss0.500000
photic zone0.500000
phyllosphere0.500000
ph 7-90.500000
quarry0.500000
duluth complex0.500000
LOWER IN depth 2.5cm0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
jiulong river0.500000
downstream0.500000
LOWER IN upstream0.500000
LOWER IN soilwater0.500000
soilwater0.500000
ph 5.50.500000
boechera stricta0.500000
grassland0.500000
alpine soil0.500000
north china plain0.500000
ph>80.500000
ph>7, ph<80.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
galium mollugo0.500000
hedge bedstraw0.500000
LOWER IN other plants0.500000
LOWER IN common sainfoin0.500000
LOWER IN onobrychis viciifolia0.500000
other plants0.500000
plantago lanceolata0.500000
ribwort plantain0.500000
festuca rubra0.500000
red fescue grass0.500000
geranium pratense0.500000
meadow geranium0.500000
lathyrus pratensis0.500000
meadow pea-vine0.500000
onobrychis viciifolia0.500000
common sainfoin0.500000
prunella vulgaris0.500000
woundwort0.500000
veronica chamaedrys0.500000
germander speedwell0.500000
LOWER IN quasipaa spinosa0.500000
LOWER IN giant spiny frog0.500000
svalbard archipelago0.500000
permafrost0.500000
permafrost active layer0.500000
permafrost transition layer0.500000
LOWER IN depth 100-150cm0.500000
LOWER IN depth 150-200cm0.500000
cambridgeshire0.500000
triturus cristatus0.500000
lissotriton vulgaris0.500000
ph 5.40.500000
snow covered soil0.500000
LOWER IN non snow covered soil0.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
southern temperate forest0.500000
temperate broadleaf and mixed forest biome0.500000
montane forest0.500000
mediterranean forest biome0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.532967
united states of america0.346154
china0.258242
rhizosphere0.241758
canada0.087912
depth (soil) 0-10cm0.087912
depth (soil) 0-20cm0.076923
farm0.071429
root0.065934
germany0.065934
water0.060440
freshwater lake0.054945
bog lake0.054945
state of wisconsin0.054945
state of new york0.049451
ph 60.049451
forest ecosystem0.049451
wheat0.049451
fresh water0.049451
state of idaho0.049451
agricultural feature0.049451
cannabis sativa0.049451
skin0.043956
triticum aestivum0.043956
topsoil0.043956
woodland area0.038462
state of california0.038462
river0.038462
winter0.038462
state of michigan0.038462
kellogg biological station0.038462
mesic type hapludalf0.038462
kalamazoo loam0.038462
north china plain0.032967
permafrost0.032967
hypolimnion0.032967
robinia pseudoacacia0.032967
reforestation0.032967
silt loam0.032967
loess plateau0.032967
shaanxi province0.032967
glycine max0.027473
depth (water) 1m0.027473
mississippi river0.027473
depth (soil) 0-5cm0.027473
coarse-loamy soil0.027473
yunwushan national natural grassland protection zone0.027473
ningxia province0.027473
calci-orthic aridisol0.027473
haplic calcisol0.027473
grazing exclusion0.027473
peatland0.021978
peat soil0.021978
depth 5cm0.021978
united kingdom0.021978
merlot0.021978
vitis vinifera0.021978
grapevine0.021978
solanum lycopersicum0.021978
LOWER IN root0.021978
downstream0.021978
brassicaceae0.021978
boechera stricta0.021978
plant0.021978
kingdom of norway0.021978
svalbard archipelago0.021978
adult0.021978
cultivated environment0.021978
brazil0.021978
day 820.021978
epilimnion0.021978
ph 4.5-50.021978
dimictic lake0.021978
meromictic lake0.021978
panicum virgatum0.021978
state of florida0.016484
fen0.016484
ph<60.016484
LOWER IN soil0.016484
tundra0.016484
bulk soil0.016484
province of quebec0.016484
newt0.016484
cambridgeshire0.016484
heilongjiang province0.016484
zea mays0.016484
black soil0.016484
mollisol0.016484
free floating0.016484
filtered 0.2um0.016484
lower mississippi river0.016484
whole body0.016484
minas gerais state0.016484
campos rupestres0.016484
root endosphere0.016484
israel0.016484
early flowering stage0.016484
"trout bog" lake0.016484
nanjing county0.016484
chrysanthemum0.016484
Exp. ID User ID Description Date Region Flag Sequences
492amnoncommon skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 55
356amnonlower in non-snow covered period ( high in snow snow covered soil winter compared to non snow covered soil summer in soil depth (soil) 0-10cm hokkaido topsoil ph 5.4 forest ecosystem japan )2018-08-15v4No1 / 78
426amnoncommon soil, tundra, permafrost, russia, nenets autonomous okrug2018-12-08v4No1 / 81
718amnoncommon hypolimnion, "west sparkling bog" lake, polymictic lake, ph 5-5.5, freshwater lake, bog lake, united states of america, state of wisconsin2028-05-23v4No1 / 112
205amnonhigher in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth (soil) 15cm depth compared to depth 2.5cm in rock united states of america quarry duluth complex ph 4-5 state of minnesota sulfide )2017-10-03v4No1 / 120
718amnoncommon epilimnion, "trout bog" lake, ph 4.5-5, dimictic lake, freshwater lake, bog lake, united states of america, state of wisconsin2028-05-23v4No1 / 121
618amnon high in cbd shark cannabis plant compared to cbd yummy cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 139
718amnoncommon "west sparkling bog" lake, polymictic lake, ph 5-5.5, epilimnion, freshwater lake, bog lake, united states of america, state of wisconsin2028-05-23v4No1 / 140
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
536amnoncommon snake, skin, united states of america, southern united states, pantherophis obsoletus, black rat snake, arboreal snake2019-07-28v4No1 / 184
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
718amnoncommon hypolimnion, "trout bog" lake, ph 4.5-5, dimictic lake, freshwater lake, bog lake, united states of america, state of wisconsin2028-05-23v4No1 / 196
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
618amnoncommon early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 205
443amnoncommon mississippi river, water, river, fresh water, depth (water) 1m, united states of america, free floating, filtered 0.2um, uppper mississippi river, upstream2019-01-07v4No1 / 219
169amnoncommon depth (water) 20-100cm, lake, fresh water, water, canada, depth (water) 0-100cm, photic zone2017-07-24v4No1 / 234
279amnoncommon grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 253
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
746sheryoHigh in saline soil fertilized with chemical fertilizer compared to biological fertilizer, planted with tomatos, in dafeng, china ( high in chemical fertilization n,p,k compared to trichoderma guizhouense njau 4742 chicken manure biological fertilization in saline soil solonchak china dafeng city jiangsu province ph 7.5 solanum lycopersicum )2021-03-03v4No1 / 269
602sheryohigher in rhizoshere of tomato plant roots planted in potting mix amended with biochar ( high in amended with biochar compared to unamended in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 270
907amnoncommon state of minnesota, bioreactor, wastewater treatment plant, united states of america2022-05-19v4No1 / 279
156amnoncommon brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 292
618amnoncommon pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 318
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth (water) 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 349
767sheryoHigh in conservation tillage compared to conventional tillage soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' in Nanjing China ( high in conservation tillage compared to deep plough conventional tillage in dazomet soil fumigation soil ph 6.9 chrysanthemum morifolium ramat. chrysanthemum china nanjing county bio-organic fertilizer compost biofilter paenibacillus polymyxa paenibacillus compost soil pig manure )2021-04-18v4No1 / 350
309amnon high in other plants compared to common sainfoin onobrychis viciifolia in rhizosphere germany 2018-04-05v4No1 / 355
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 377
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No1 / 396
912amnon high in alive compared to dead in zebra mussel dreissena polymorpha fresh water aquarium mussel whole body body proper research facility 2022-05-27v4No1 / 398
718amnoncommon hypolimnion, meromictic lake, "hells kitchen" lake, freshwater lake, bog lake, united states of america, state of wisconsin2028-05-23v4No1 / 400
347amnoncommon depth (soil) 0-20cm, kingdom of norway, svalbard archipelago, permafrost, soil, permafrost active layer2018-07-15v4No1 / 405
147amnoncommon pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
618amnon high in hash cannabis plant compared to cbd yummy cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 416
360amnoncommon desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 432
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
254amnonlower in river when close to populated region compared to downstream ( high in downstream compared to upstream city populated place in river water fresh water depth (soil) 50cm jiulong river fujian province china )2017-11-23v4No1 / 468
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
813amnoncommon intact branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 475
347amnon high in depth (soil) 0-20cm permafrost transition layer compared to depth (soil) 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 477
718amnon high in epilimnion compared to hypolimnion in freshwater lake bog lake united states of america state of wisconsin ph 4.5-5 dimictic lake "north sparkling bog" lake 2028-05-23v4No1 / 488
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
718amnon high in epilimnion compared to hypolimnion in "trout bog" lake ph 4.5-5 dimictic lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 509
618amnoncommon pre-vegetative stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 530
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
718amnoncommon hypolimnion, "mary lake", ph 5.5-6, meromictic lake, freshwater lake, bog lake, united states of america, state of wisconsin2028-05-23v4No1 / 559
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 567
443amnoncommon particles, mississippi river, water, river, fresh water, depth (water) 1m, united states of america, filtered 2.7um, downstream, lower mississippi river2019-01-07v4No1 / 568
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
444amnonhigher in continuously cropped strawberry soil ( high in continuous cropping age 5 years age 10 years compared to age 1 year in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 602
309amnon high in galium mollugo hedge bedstraw compared to other plants in rhizosphere germany 2018-04-05v4No1 / 618
813amnoncommon severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 633
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
53amnonhigher in wastewater plant effluent compared to influent and sewer in south america ( high in effluent compared to influent sewage in south america city wastewater treatment plant )2017-01-21v4No1 / 657
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth (soil) 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth (soil) 20-30cm2018-07-15v4No1 / 698
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
791sheryoHigher at 0cm depth compared to 80cm depth in low saline low sodicity soil in China ( high in depth (soil) 0-20cm depth 0cm compared to depth (soil) 80cm in ph 9 low salinity low sodicity soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 748
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
443amnon high in free floating filtered 0.2um compared to particles filtered 2.7um in water river fresh water depth (water) 1m united states of america mississippi river 2019-01-07v4No1 / 755
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
615amnoncommon in control soil with no sugarcane (common campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 780
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 807
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
618amnoncommon late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 819
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
769sheryocommon in conventional tillage wheat field in northern israel (common conventional tillage, bulk soil, soil, vertisol, israel, northen israel, triticum aestivum)2021-04-18v4No1 / 861
769sheryocommon in no tillage wheat field in northern israel (common bulk soil, soil, vertisol, israel, northen israel, no tillage, triticum aestivum)2021-04-18v4No1 / 871
618amnoncommon early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 873
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 875
171amnoncommon in soil with rice growth irrigation protocol (common soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in ph 8.5 low sodicity low salinity compared to ph 10.5 high sodicity high salinity in depth (soil) 0-20cm depth 0cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 932
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common depth (soil) 0-20cm, ph 8.5, depth 0cm, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 1035
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1038
618amnon high in early flowering stage compared to late flowering stage in rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 1040
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1080
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
718amnon high in hypolimnion compared to epilimnion in meromictic lake "hells kitchen" lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 1165
746sheryoCommon in saline soil in dafeng, china (common ph 7.6, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 1170
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
309amnoncommon lathyrus pratensis, rhizosphere, germany, meadow pea-vine2018-04-05v4No1 / 1296
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1383
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in lower mississippi river downstream compared to upper mississippi river upstream in particles mississippi river water river fresh water depth (water) 1m united states of america filtered 2.7um )2019-01-07v4No1 / 1418
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1477
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
101amnon high in root compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 2075
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
718amnon high in hypolimnion compared to epilimnion in "mary lake" ph 5.5-6 meromictic lake freshwater lake bog lake united states of america state of wisconsin 2028-05-23v4No1 / 2370
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3893
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 3932
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org