Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGCAGGCGGTCTTCCAAGTCAGTGGTGAAAGCCCGGAGCTCAACTCCGGAACTGCCATTGAAACTGTAAGACTTGAGGATGAGAGAGGTGAGTGGAATTCCCAG
common ontology terms
term enrichment score
TermScore
soil0.632162
rhizosphere0.323612
china0.211997
depth (soil) 0-20cm0.194437
agricultural field0.155469
triticum aestivum0.147382
grand river watershed0.125490
rare charitable research reserve0.125490
depth (soil) 0-10cm0.124191
silt loam0.118577
wheat0.113667
forested area0.113667
canada0.113402
cultivated environment0.111554
pot expreiment0.111554
topsoil0.110020
cambridge0.105611
province of ontario0.100313
bulk soil0.098361
zea mays0.091160
lettuce0.089796
luvisol0.089796
germany0.083582
orchard0.082305
depth (soil) 0-30 cm0.076596
kellogg biological station0.074689
mesic type hapludalf0.074689
kalamazoo loam0.074689
robinia pseudoacacia0.074689
shaanxi province0.074689
reforestation0.074689
quercus velutina0.074689
quercus alba0.074689
quercus rubra0.074689
acer saccharum0.074689
acer saccharum subsp. nigrum0.074689
fagus grandifolia0.074689
forest0.074689
united states of america0.073257
loess plateau0.072000
thyrow0.066946
dekalb county0.066946
illinois0.066946
citrus0.065844
brazil0.064430
forest ecosystem0.061776
switzerland0.061776
maize field0.060258
woodland area0.059925
ph 60.059072
ph 7.60.059072
depth 0-15cm0.059072
root0.058212
state of michigan0.057508
agricultural feature0.057348
state of illinois0.055749
park0.051724
mollisol0.051724
north china plain0.051064
20 years0.051064
mineral fertilization0.051064
albic luvisol0.051064
alabama0.051064
ultisol0.051064
mature forest0.051064
ph 70.050420
fertilized soil0.050420
npk fertilization0.049793
haplic luvisol0.049793
auburn0.049793
surface water0.048583
fresh water0.047782
tree0.047431
state of new york0.045802
united kingdom0.045603
luancheng county0.043384
oak0.042918
crop rotation0.042918
bernburg0.042918
brunisol0.042918
glycine max0.042614
greenhouse0.042017
quercus0.042017
mexico0.040733
kingdom of denmark0.040733
state of tennessee0.040323
winter0.035608
depth (soil) 10-25cm0.035242
cambisol0.034934
black soil0.034934
saccharum0.034934
sugarcane0.034934
merlot0.034632
grapevine0.034632
guanajuato0.034632
populus0.034632
lushan mountain0.034632
kaiyang county0.034632
guizhou province0.034632
hapludalf0.034632
Fraction of dbbact annotations with this term covered by the query
TermScore
ph 6-6.51.000000
depth (soil) 10-25cm1.000000
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
sonneratia apetala1.000000
qiao nature reserve1.000000
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
banana1.000000
musa acuminata1.000000
deep bay1.000000
mirs bay1.000000
volcan sumaco1.000000
cinnamomum camphora1.000000
anxi county1.000000
river water1.000000
fuzhou city prefecture1.000000
xiyuan river1.000000
depth (soil) 0-30 cm0.750000
maize field0.750000
park0.666667
ph 5.60.666667
soybean0.666667
cambisol0.666667
black soil0.666667
mollisol0.666667
ph 4-60.666667
saccharum0.666667
sugarcane0.666667
depth (soil) 0-15cm0.666667
ph 80.666667
luancheng county0.666667
fusarium oxysporum0.666667
wheat0.600000
zea mays0.600000
forested area0.600000
agricultural field0.583333
bulk soil0.571429
rhizosphere0.553191
triticum aestivum0.545455
soil0.544554
non-seleniferous0.500000
LOWER IN seleniferous0.500000
temperate grassland biome0.500000
flooded grassland biome0.500000
vero beach, fl0.500000
central park0.500000
merlot0.500000
grapevine0.500000
winter barley0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root zone soil0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN temperate0.500000
temperate0.500000
rice0.500000
tomato0.500000
slit loam soil0.500000
ph 60.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
arachis hypogaea0.500000
peanut0.500000
LOWER IN soilwater0.500000
north china plain0.500000
ph>80.500000
ph>7, ph<80.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
svalbard archipelago0.500000
permafrost transition layer0.500000
ph 5.40.500000
temperate woodland biome0.500000
temperate deciduos forest0.500000
ph<50.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
montane forest0.500000
mediterranean forest biome0.500000
savanna0.500000
agave0.500000
root endosphere0.500000
agave salmiana0.500000
guanajuato0.500000
cultivated environment0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.753363
china0.327354
rhizosphere0.228700
united states of america0.174888
depth (soil) 0-20cm0.152466
canada0.098655
agricultural field0.089686
triticum aestivum0.085202
depth (soil) 0-10cm0.071749
grand river watershed0.071749
province of ontario0.071749
cambridge0.071749
rare charitable research reserve0.071749
silt loam0.067265
germany0.062780
wheat0.062780
topsoil0.062780
cultivated environment0.062780
forested area0.062780
pot expreiment0.062780
bulk soil0.053812
zea mays0.049327
lettuce0.049327
luvisol0.049327
orchard0.044843
depth (soil) 0-30 cm0.040359
state of michigan0.040359
kellogg biological station0.040359
mesic type hapludalf0.040359
kalamazoo loam0.040359
robinia pseudoacacia0.040359
loess plateau0.040359
shaanxi province0.040359
reforestation0.040359
quercus velutina0.040359
quercus alba0.040359
quercus rubra0.040359
acer saccharum0.040359
acer saccharum subsp. nigrum0.040359
fagus grandifolia0.040359
forest0.040359
woodland area0.035874
citrus0.035874
agricultural feature0.035874
forest ecosystem0.035874
brazil0.035874
switzerland0.035874
thyrow0.035874
dekalb county0.035874
illinois0.035874
state of illinois0.035874
united kingdom0.031390
root0.031390
ph 60.031390
fresh water0.031390
maize field0.031390
ph 7.60.031390
depth 0-15cm0.031390
park0.026906
state of new york0.026906
tree0.026906
north china plain0.026906
winter0.026906
mollisol0.026906
20 years0.026906
ph 70.026906
fertilized soil0.026906
mineral fertilization0.026906
npk fertilization0.026906
albic luvisol0.026906
haplic luvisol0.026906
surface water0.026906
auburn0.026906
alabama0.026906
ultisol0.026906
mature forest0.026906
mexico0.022422
glycine max0.022422
state of tennessee0.022422
greenhouse0.022422
water0.022422
kingdom of denmark0.022422
oak0.022422
quercus0.022422
luancheng county0.022422
crop rotation0.022422
bernburg0.022422
brunisol0.022422
merlot0.017937
vitis vinifera0.017937
grapevine0.017937
LOWER IN root0.017937
solanum lycopersicum0.017937
state of california0.017937
desert0.017937
guanajuato0.017937
cambisol0.017937
manured soil0.017937
black soil0.017937
italy0.017937
Exp. ID User ID Description Date Region Flag Sequences
882amnondominant antarctic pearlwort, colobanthus quitensis, king george island, antarctica, rhizosphere2022-03-20v3No1 / 8
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 17
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol compared to organic fertilized from Germany ( high in mineral fertilization npk fertilization compared to manured soil manure fertilization organic fertilization in germany soil bulk soil thyrow albic luvisol ph 6.4 lettuce pot expreiment )2021-04-07v3No1 / 38
733amnon high in filtered 0.2um free floating compared to filtered 2.7um particle bound in depth (water) 1m lago grande do curuai river amazon lake water fresh water water brazil 2021-01-17v3No1 / 46
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 87
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in soil germany bernburg loess chernozem conventional tillage mouldboard plough ph 7.6 triticum aestivum crop rotation )2021-04-12v3No1 / 91
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth (soil) 50cm2019-09-14v3No1 / 94
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth (water) 10m2019-09-14v3No1 / 123
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth (water) 40m2019-09-14v3No1 / 129
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, forest, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus velutina, quercus alba, quercus rubra, mature forest, forested area, brunisol, soil, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 182
733amnoncommon filtered 0.2um, free floating, depth (water) 1m, lago grande do curuai, river amazon, lake water, fresh water, water, brazil2021-01-17v3No1 / 210
855sheryoHigher in soil depth of 350cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 350cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 217
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 227
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
602sheryohigher in rhizoshere of tomato plant roots planted in unamended potting mix ( high in unamended compared to amended with biochar in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 252
996amnoncommon in river water without anthropogenic effect (common river water, china, upstream, fuzhou city prefecture, xiyuan river, fresh water, surface water, river)2022-12-28v3No1 / 254
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 261
951amnoncommon mirs bay, depth (water) 20-100cm, coast, china, surface water, sea water2022-12-08v3No1 / 263
698amnon high in ph 5-6 plant disease disease acute oak decline compared to ph 6-7 control in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 266
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v3No1 / 286
882amnoncommon antarctic hairgrass, deschampsia antarctica, king george island, antarctica, rhizosphere2022-03-20v3No1 / 299
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common china, shandong province, luojiazhuang, fusarium oxysporum, solanum lycopersicum, soil)2021-03-11v3No1 / 305
752sheryoHigher in treatments with biochar compared to treatments without biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in biochar compared to without biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 317
882amnoncommon king george island, antarctic pearlwort, colobanthus quitensis, antarctica, rhizosphere2022-03-20v3No1 / 325
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-núcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
750sheryoCommon in soil of wheat field in China (common fluvo-aquic soil, ph 7.6, hebei province, luancheng county, china, triticum aestivum, soil)2021-03-11v3No1 / 337
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to organic fertilization bio-dynamic fertilizer manure fertilization manured soil in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 347
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 353
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common organic fertilization, manure fertilization, manured soil, albic luvisol, thyrow, germany, rhizosphere, soil, lettuce, pot expreiment)2021-04-08v3No1 / 359
951amnoncommon in ocean water close to river outlet (common depth (water) 20-100cm, coast, deep bay, china, surface water, sea water)2022-12-08v3No1 / 372
798amnon high in hay litter bag plant litter compared to ph 7-8 soil in depth (soil) 10 cm depth (soil) 0-20cm orchard apricot prunus armeniaca apennine mountains italy 2021-06-13v3No1 / 377
813amnonhigher in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in intact branch compared to severed branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 390
842sheryoCommon in soil depth of 30-45cm in an old growth forest in Ontario, Canada (common depth 30-45cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 390
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 393
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 395
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 415
855sheryoHigher in soil depth of 350cm compared to soil depth of 800cm in fertilized soil in china ( high in depth 350cm compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 418
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 433
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 455
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 460
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
347amnon high in depth (soil) 0-20cm permafrost transition layer compared to depth (soil) 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 477
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 491
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
942amnoncommon banana, rhizosphere, nanning city prefecture, china, musa acuminata2022-11-25v3No1 / 505
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 507
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, hay, plant litter, litter bag, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 508
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 116-140cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 516
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 530
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 576
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
842sheryoHigher in soil depth of 0-15cm compared soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in dipsacus fullonum solidago apocynum daucus carota brunisol decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 601
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common ph 6.6, manured soil, manure fertilization, organic fertilization, bio-dynamic fertilizer, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 602
662amnoncommon loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 609
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
616amnon high in ph 5.5-6 fertilized soil compared to ph 6.7 non-fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 648
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 648
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth (soil) 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 701
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
615amnoncommon endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 776
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
996amnon high in upstream compared to city anthropogenic environmental material downstream in river surface water fresh water xiyuan river fuzhou city prefecture china river water 2022-12-28v3No1 / 894
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 901
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
854sheryoCommon in soil depth of 25-50cm of colluvial soil, Czech rebuplic (common ph 8, calcic chernozem, czech republic, south moravian region, colluvial soil, depth 25-50cm, soil)2021-12-23v3No1 / 905
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1082
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph<5 compared to ph>5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1107
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
507amnon high in sediment depth 0-5cm compared to sediment depth 8-10cm in lake sediment sediment canada quesnel lake province of british columbia 2019-03-17v4No1 / 1157
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
917amnoncommon ph 7-8, futian national nature reserve, depth (soil) 0-20cm, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 1197
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1281
917amnoncommon ph 6-6.5, futian national nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, soil, saline marsh2022-07-08v3No1 / 1290
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1294
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common 20 years, depth 0-40cm, robinia pseudoacacia, loess plateau, shaanxi province, china, reforestation, silt loam, soil)2021-09-26v4No1 / 1323
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
917amnoncommon ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1379
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
462amnon high in depth (soil) 0-30 cm depth (soil) 0-20cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
842sheryoHigher in soil depth of 0-15cm compared to 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1723
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1819
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
84amnoncommon depth 20cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-06v4No1 / 2866
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3893
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 3932
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org