Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGCAGGTGGTCTTTCAAGTCAGTGGTGAAAGCCCGGAGCTCAACTCCGGAAATGCCATTGAAACTGTAAGACTTGAGGATGAGAGAGGTGAGTGGAATTCCCAG
common ontology terms
term enrichment score
TermScore
soil0.415862
agricultural field0.226190
rhizosphere0.203547
grand river watershed0.197531
rare charitable research reserve0.197531
depth (soil) 0-20cm0.185577
pot expreiment0.177215
triticum aestivum0.166172
bulk soil0.158940
cambridge0.152381
china0.147844
lettuce0.144737
luvisol0.144737
province of ontario0.141593
wheat0.136364
quercus velutina0.121622
quercus alba0.121622
quercus rubra0.121622
acer saccharum0.121622
acer saccharum subsp. nigrum0.121622
fagus grandifolia0.121622
forest0.121622
ph 60.109589
thyrow0.109589
dekalb county0.109589
illinois0.109589
forested area0.102857
maize field0.100478
ph 7.60.097222
depth (soil) 0-30 cm0.097222
depth 0-15cm0.097222
germany0.096774
switzerland0.096386
depth (soil) 0-10cm0.091653
mineral fertilization0.084507
albic luvisol0.084507
alabama0.084507
ultisol0.084507
mature forest0.084507
ph 70.082759
fertilized soil0.082759
state of illinois0.082474
npk fertilization0.081081
haplic luvisol0.081081
auburn0.081081
surface water0.077922
luancheng county0.072727
oak0.071429
crop rotation0.071429
bernburg0.071429
brunisol0.071429
fresh water0.070000
biochar0.069767
park0.068966
quercus0.068966
zea mays0.068182
kingdom of denmark0.065574
kaiyang county0.057971
guizhou province0.057971
hapludalf0.057971
alfisol0.057971
depth 15-30cm0.057971
depth 30-45cm0.057971
dipsacus fullonum0.057971
solidago0.057971
apocynum0.057971
decomissioned agricultural field0.057971
meadow ecosystem0.057971
filtered 0.2um0.056338
mollisol0.056338
sandy loam0.056338
sandy loam soil0.056338
daucus carota0.056338
marsh0.056338
canada0.052459
silt loam0.051948
ph 7-80.051502
french republic0.050633
depth (soil) 10-25cm0.044610
coarse-loamy soil0.044118
day 820.044118
elevation 2000-3000m0.044118
after 6 years0.044118
panax notoginseng0.044118
sanqi plants0.044118
xundian county0.044118
ph 6.40.044118
organic fertilization0.044118
therwil0.044118
apricot0.044118
prunus armeniaca0.044118
apennine mountains0.044118
upland soil0.044118
foot slope 0.044118
preston flats0.044118
old growth forest0.044118
king george island0.044118
futian national nature reserve0.044118
depth (soil) 0-5cm0.043165
mountain0.043165
Fraction of dbbact annotations with this term covered by the query
TermScore
sonneratia apetala1.000000
qiao nature reserve1.000000
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
banana1.000000
musa acuminata1.000000
deep bay1.000000
mirs bay1.000000
volcan sumaco1.000000
cinnamomum camphora1.000000
anxi county1.000000
river water1.000000
fuzhou city prefecture1.000000
xiyuan river1.000000
maize field0.750000
ph 80.666667
luancheng county0.666667
fusarium oxysporum0.666667
depth (soil) 10-25cm0.666667
wheat0.600000
bulk soil0.571429
tomato0.500000
slit loam soil0.500000
ph 60.500000
north china plain0.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment 0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
continuous corn0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
calcareous parent material0.500000
baijiu0.500000
hefei city prefecture0.500000
days 0-900.500000
agricultural field0.500000
high biochar0.500000
low biochar0.500000
straw0.500000
kaiyang county0.500000
guizhou province0.500000
after 6 years0.500000
ph 7.60.500000
loamy sand soil0.500000
neve yaar0.500000
LOWER IN plectostoma concinnum0.500000
LOWER IN opisthostoma concinnum0.500000
georissa0.500000
georissa similis0.500000
state of sabah0.500000
alycaeus jagori0.500000
depth (soil) 0-30 cm0.500000
oak0.500000
acute oak decline0.500000
lago grande do curuai0.500000
river amazon0.500000
fluvo-aquic soil0.500000
luojiazhuang0.500000
panax notoginseng0.500000
sanqi plants0.500000
xundian county0.500000
pot expreiment0.500000
bacillus amyloliquefaciens sqr90.500000
oryza rufipogon0.500000
lower saxony0.500000
sandy soil0.500000
mineral fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
organic fertilization0.500000
LOWER IN organic fertilization0.500000
therwil0.500000
ph 6.60.500000
bio-dynamic fertilizer0.500000
LOWER IN bio-dynamic fertilizer0.500000
crop rotation0.500000
mouldboard plough0.500000
loess chernozem0.500000
bernburg0.500000
LOWER IN maize pre-crop0.500000
rapeseed pre-crop0.500000
cultivator tillage0.500000
maize pre-crop0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.753846
china0.307692
depth (soil) 0-20cm0.176923
rhizosphere0.169231
agricultural field0.146154
united states of america0.130769
grand river watershed0.123077
canada0.123077
province of ontario0.123077
cambridge0.123077
rare charitable research reserve0.123077
triticum aestivum0.107692
pot expreiment0.107692
germany0.100000
bulk soil0.092308
lettuce0.084615
luvisol0.084615
wheat0.076923
quercus velutina0.069231
quercus alba0.069231
quercus rubra0.069231
acer saccharum0.069231
acer saccharum subsp. nigrum0.069231
fagus grandifolia0.069231
forest0.069231
forested area0.069231
ph 60.061538
switzerland0.061538
thyrow0.061538
dekalb county0.061538
illinois0.061538
state of illinois0.061538
depth (soil) 0-10cm0.053846
fresh water0.053846
maize field0.053846
ph 7.60.053846
depth (soil) 0-30 cm0.053846
depth 0-15cm0.053846
ph 70.046154
fertilized soil0.046154
mineral fertilization0.046154
npk fertilization0.046154
albic luvisol0.046154
haplic luvisol0.046154
surface water0.046154
auburn0.046154
alabama0.046154
ultisol0.046154
mature forest0.046154
biochar0.038462
water0.038462
kingdom of denmark0.038462
park0.038462
united kingdom0.038462
oak0.038462
quercus0.038462
luancheng county0.038462
zea mays0.038462
crop rotation0.038462
bernburg0.038462
brunisol0.038462
french republic0.030769
ph 7-80.030769
kaiyang county0.030769
guizhou province0.030769
filtered 0.2um0.030769
sea water0.030769
mollisol0.030769
silt loam0.030769
sandy loam0.030769
sandy loam soil0.030769
hapludalf0.030769
alfisol0.030769
depth 15-30cm0.030769
depth 30-45cm0.030769
dipsacus fullonum0.030769
solidago0.030769
apocynum0.030769
daucus carota0.030769
decomissioned agricultural field0.030769
meadow ecosystem0.030769
marsh0.030769
solanum lycopersicum0.023077
root0.023077
LOWER IN rhizosphere0.023077
brazil0.023077
depth (soil) 0-5cm0.023077
state of new york0.023077
coarse-loamy soil0.023077
day 820.023077
lake0.023077
freshwater lake0.023077
mountain0.023077
elevation 2000-3000m0.023077
after 6 years0.023077
panax notoginseng0.023077
sanqi plants0.023077
xundian county0.023077
yunnan province0.023077
ph 6.40.023077
Exp. ID User ID Description Date Region Flag Sequences
882amnondominant antarctic pearlwort, colobanthus quitensis, king george island, antarctica, rhizosphere2022-03-20v3No1 / 8
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 17
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol compared to organic fertilized from Germany ( high in mineral fertilization npk fertilization compared to manured soil manure fertilization organic fertilization in germany soil bulk soil thyrow albic luvisol ph 6.4 lettuce pot expreiment )2021-04-07v3No1 / 38
733amnon high in filtered 0.2um free floating compared to filtered 2.7um particle bound in depth (water) 1m lago grande do curuai river amazon lake water fresh water water brazil 2021-01-17v3No1 / 46
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in soil germany bernburg loess chernozem conventional tillage mouldboard plough ph 7.6 triticum aestivum crop rotation )2021-04-12v3No1 / 91
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth (soil) 50cm2019-09-14v3No1 / 94
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth (water) 10m2019-09-14v3No1 / 123
557amnoncommon lake, freshwater lake, fresh water, water, french republic, depth (water) 40m2019-09-14v3No1 / 129
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, forest, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus velutina, quercus alba, quercus rubra, mature forest, forested area, brunisol, soil, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 182
733amnoncommon filtered 0.2um, free floating, depth (water) 1m, lago grande do curuai, river amazon, lake water, fresh water, water, brazil2021-01-17v3No1 / 210
855sheryoHigher in soil depth of 350cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 350cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 217
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 227
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
996amnoncommon in river water without anthropogenic effect (common river water, china, upstream, fuzhou city prefecture, xiyuan river, fresh water, surface water, river)2022-12-28v3No1 / 254
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 261
951amnoncommon mirs bay, depth (water) 20-100cm, coast, china, surface water, sea water2022-12-08v3No1 / 263
698amnon high in ph 5-6 plant disease disease acute oak decline compared to ph 6-7 control in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 266
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v3No1 / 286
882amnoncommon antarctic hairgrass, deschampsia antarctica, king george island, antarctica, rhizosphere2022-03-20v3No1 / 299
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common china, shandong province, luojiazhuang, fusarium oxysporum, solanum lycopersicum, soil)2021-03-11v3No1 / 305
752sheryoHigher in treatments with biochar compared to treatments without biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in biochar compared to without biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 317
882amnoncommon king george island, antarctic pearlwort, colobanthus quitensis, antarctica, rhizosphere2022-03-20v3No1 / 325
750sheryoCommon in soil of wheat field in China (common fluvo-aquic soil, ph 7.6, hebei province, luancheng county, china, triticum aestivum, soil)2021-03-11v3No1 / 337
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to organic fertilization bio-dynamic fertilizer manure fertilization manured soil in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 347
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 353
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common organic fertilization, manure fertilization, manured soil, albic luvisol, thyrow, germany, rhizosphere, soil, lettuce, pot expreiment)2021-04-08v3No1 / 359
951amnoncommon in ocean water close to river outlet (common depth (water) 20-100cm, coast, deep bay, china, surface water, sea water)2022-12-08v3No1 / 372
798amnon high in hay litter bag plant litter compared to ph 7-8 soil in depth (soil) 10 cm depth (soil) 0-20cm orchard apricot prunus armeniaca apennine mountains italy 2021-06-13v3No1 / 377
842sheryoCommon in soil depth of 30-45cm in an old growth forest in Ontario, Canada (common depth 30-45cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 390
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 393
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 415
855sheryoHigher in soil depth of 350cm compared to soil depth of 800cm in fertilized soil in china ( high in depth 350cm compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 418
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 433
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 455
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 460
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 491
942amnoncommon banana, rhizosphere, nanning city prefecture, china, musa acuminata2022-11-25v3No1 / 505
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 507
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, hay, plant litter, litter bag, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 508
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 116-140cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 516
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 530
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 576
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
842sheryoHigher in soil depth of 0-15cm compared soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in dipsacus fullonum solidago apocynum daucus carota brunisol decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 601
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common ph 6.6, manured soil, manure fertilization, organic fertilization, bio-dynamic fertilizer, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 602
662amnoncommon loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 609
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
616amnon high in ph 5.5-6 fertilized soil compared to ph 6.7 non-fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 648
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 648
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 701
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
996amnon high in upstream compared to city anthropogenic environmental material downstream in river surface water fresh water xiyuan river fuzhou city prefecture china river water 2022-12-28v3No1 / 894
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
854sheryoCommon in soil depth of 25-50cm of colluvial soil, Czech rebuplic (common ph 8, calcic chernozem, czech republic, south moravian region, colluvial soil, depth 25-50cm, soil)2021-12-23v3No1 / 905
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1082
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1107
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
917amnoncommon ph 7-8, futian national nature reserve, depth (soil) 0-20cm, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 1197
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1281
917amnoncommon ph 6-6.5, futian national nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, soil, saline marsh2022-07-08v3No1 / 1290
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
917amnoncommon ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1379
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1383
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1672
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
842sheryoHigher in soil depth of 0-15cm compared to 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1723
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org