Search result for sequence:
TACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGTGTAGGCGGGTCTTTAAGTCAGGGGTGAAATGCCAAGGCTCAACCTTGGAACTGCCTTTGATACTGGAGACCTTGAGTCCGGGAGAGGTGAGTGGAATTGCGAG
common ontology terms
term enrichment score
TermScore
soil0.349142
rhizosphere0.300233
bulk soil0.169014
wheat0.166667
depth (soil) 0-20cm0.150754
park0.141176
minas gerais state0.136364
campos rupestres0.136364
lettuce0.136364
forested area0.131868
topsoil0.127660
brazil0.126316
depth (soil) 0-10cm0.125654
pot expreiment0.120000
china0.116592
north china plain0.116279
cultivated environment0.116279
oak0.116279
alabama0.116279
ultisol0.116279
dekalb county0.116279
illinois0.116279
quercus0.109890
auburn0.109890
depth (soil) 0-30 cm0.104167
switzerland0.101523
depth (soil) 10-25cm0.100000
root0.099010
triticum aestivum0.096618
thyrow0.095238
upland soil0.095238
haplic luvisol0.090909
state of illinois0.086207
agricultural field0.073529
barbacenia macrantha0.073171
lushan mountain0.073171
mesocosm0.073171
mineral fertilization0.073171
albic luvisol0.073171
grand river watershed0.073171
rare charitable research reserve0.073171
quercus velutina0.073171
quercus alba0.073171
quercus rubra0.073171
acer saccharum0.073171
acer saccharum subsp. nigrum0.073171
fagus grandifolia0.073171
forest0.073171
farm0.072639
npk fertilization0.070588
mollisol0.070588
hunan province0.069364
agricultural feature0.068493
forest ecosystem0.067039
LOWER IN root0.065934
tree0.065934
zea mays0.065934
cambridge0.065934
woodland area0.064865
germany0.064103
jiangxi province0.063830
silt loam0.063830
province of ontario0.063830
ph 4-50.062827
state of georgia0.060000
winter0.058480
cinnamomum camphora0.051282
anxi county0.051282
united kingdom0.051020
ph 5.60.050633
soybean0.050633
paddy field soil0.050633
ph 4-60.050633
taxus0.050000
taxus mairei0.050000
moist tropical forest0.050000
red soil0.050000
fragaria x ananassa0.050000
strawberry0.050000
yellow brown soil0.050000
vellozia epidendroides0.050000
lu'an city prefecture0.050000
flowerpot0.050000
elevation 2000-3000m0.050000
siliceous parent material0.050000
acute oak decline0.050000
lower saxony0.050000
sandy soil0.050000
ph 6.40.050000
therwil0.050000
depth 0-12cm0.050000
hapludalf0.050000
alfisol0.050000
mature forest0.050000
depth 0-15cm0.050000
luvisol0.050000
cambisol0.048780
ph 4.50.048780
mountain0.048780
sandy loam0.048780
Fraction of dbbact annotations with this term covered by the query
TermScore
depth (soil) 10-25cm1.000000
cuticle1.000000
chitin-based cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-nĂșcleo picinguaba1.000000
odontomachus hastatus1.000000
sao paulo state1.000000
volcan sumaco1.000000
cinnamomum camphora1.000000
anxi county1.000000
park0.666667
ph 5.60.666667
soybean0.666667
paddy field soil0.666667
ph 4-60.666667
field soil0.500000
temperate grassland biome0.500000
quincy, fl0.500000
ft. pierce, fl0.500000
central park0.500000
ph<5.50.500000
LOWER IN ph&gt;5.50.500000
merlot0.500000
grapevine0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN temperate0.500000
temperate0.500000
north china plain0.500000
ph>80.500000
ph>6, ph<70.500000
ph>5, ph<60.500000
ph>4, ph<50.500000
moist tropical forest0.500000
ph<4.50.500000
LOWER IN ph&gt;4.50.500000
subtropical broadleaf forest biome0.500000
red soil0.500000
cultivated environment0.500000
fragaria x ananassa0.500000
strawberry0.500000
yellow brown soil0.500000
LOWER IN age 10 years0.500000
LOWER IN continuous cropping0.500000
populus0.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
lushan mountain0.500000
elevation 200-300m0.500000
elevation 500-600m0.500000
elevation 1300-1400m0.500000
cherokia georgiana georgiana0.500000
millipede0.500000
mesocosm0.500000
dendrobium moniliforme0.500000
lu'an city prefecture0.500000
flowerpot0.500000
dendrobium huoshanense0.500000
miscanthus0.500000
restored prairie0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
LOWER IN gaster0.500000
tropical moist broadleaf forest biome0.500000
elevation 2000-3000m0.500000
siliceous parent material0.500000
rhone river valley0.500000
ph 4.5-70.500000
canton of graubunden0.500000
oak0.500000
acute oak decline0.500000
lower saxony0.500000
sandy soil0.500000
mineral fertilization0.500000
thyrow0.500000
albic luvisol0.500000
ph 6.40.500000
lettuce0.500000
organic fertilization0.500000
therwil0.500000
LOWER IN organic fertilization0.500000
LOWER IN bio-dynamic fertilizer0.500000
alabama0.500000
upland soil0.500000
ultisol0.500000
foot slope 0.500000
depth 0-27cm0.500000
dekalb county0.500000
illinois0.500000
depth 27-56cm0.500000
depth 0-560.500000
LOWER IN depth 56-1400.500000
depth 0-12cm0.500000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.657895
china0.342105
rhizosphere0.302632
depth (soil) 0-20cm0.197368
united states of america0.157895
wheat0.105263
bulk soil0.105263
brazil0.105263
park0.078947
topsoil0.078947
depth (soil) 0-10cm0.078947
minas gerais state0.078947
campos rupestres0.078947
forested area0.078947
lettuce0.078947
pot expreiment0.078947
root0.065789
triticum aestivum0.065789
north china plain0.065789
agricultural feature0.065789
winter0.065789
cultivated environment0.065789
farm0.065789
switzerland0.065789
depth (soil) 0-30 cm0.065789
united kingdom0.065789
oak0.065789
quercus0.065789
germany0.065789
auburn0.065789
alabama0.065789
agricultural field0.065789
ultisol0.065789
dekalb county0.065789
illinois0.065789
state of illinois0.065789
depth (soil) 10-25cm0.052632
thyrow0.052632
haplic luvisol0.052632
upland soil0.052632
LOWER IN root0.039474
tree0.039474
woodland area0.039474
forest ecosystem0.039474
hunan province0.039474
zea mays0.039474
barbacenia macrantha0.039474
jiangxi province0.039474
lushan mountain0.039474
mesocosm0.039474
state of georgia0.039474
mineral fertilization0.039474
npk fertilization0.039474
albic luvisol0.039474
mollisol0.039474
silt loam0.039474
grand river watershed0.039474
rare charitable research reserve0.039474
quercus velutina0.039474
quercus alba0.039474
quercus rubra0.039474
acer saccharum0.039474
acer saccharum subsp. nigrum0.039474
fagus grandifolia0.039474
cambridge0.039474
forest0.039474
province of ontario0.039474
canada0.039474
ph 4-50.039474
citrus0.026316
state of florida0.026316
taxus0.026316
taxus mairei0.026316
oryza sativa0.026316
ph 5.60.026316
glycine max0.026316
soybean0.026316
moist tropical forest0.026316
red soil0.026316
cambisol0.026316
ph<50.026316
paddy field soil0.026316
fragaria x ananassa0.026316
strawberry0.026316
greenhouse soil0.026316
yellow brown soil0.026316
nanjing city prefecture0.026316
age 1 year0.026316
ph 4-60.026316
vellozia epidendroides0.026316
ph 4.50.026316
lu'an city prefecture0.026316
flowerpot0.026316
research facility0.026316
greenhouse0.026316
mountain0.026316
elevation 2000-3000m0.026316
siliceous parent material0.026316
ph 4-4.50.026316
london0.026316
Exp. ID User ID Description Date Region Flag Sequences
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 17
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 261
698amnon high in ph 5-6 plant disease disease acute oak decline compared to ph 6-7 control in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 266
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-nĂșcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to organic fertilization bio-dynamic fertilizer manure fertilization manured soil in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 347
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 455
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 460
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 590
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil silt loam mollisol state of illinois illinois dekalb county )2021-08-26v3No1 / 631
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 648
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 652
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
357amnon high in ph<4.5 compared to ph>4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 915
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4262
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org