Search result for sequence:
TACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTG
common ontology terms
term enrichment score
TermScore
homo sapiens0.189274
china0.168580
united states of america0.157742
adult0.154156
water0.132189
drinking water0.120879
research facility0.106195
lung0.099861
israel0.091837
spring water0.090909
cystic fibrosis0.082111
state of florida0.079121
state of california0.078603
intestine0.078431
feces0.076471
digestive system0.074074
fresh water0.072000
australia0.071156
sinusoidal space0.071006
paranasal sinus0.071006
mild disease course0.069767
state of new hampshire0.069767
bronchoalveolar lavage0.069767
oncorhynchus mykiss0.069767
rainbow trout0.069767
soil0.064982
sweden0.061224
farm0.060120
leaf0.060000
fish0.059406
hospital0.056604
mucosa0.055556
stomach0.055556
skin0.054054
LOWER IN control0.049844
sea water0.049383
tap water0.048193
ram's horn snail0.047619
planorbella trivolvis0.047619
age 50-60 years0.047619
nanning city prefecture0.047619
agave0.047619
foot0.046512
fishmeal diet0.046512
sus scrofa0.044776
brazil0.043165
mucus0.042553
desert0.042553
child0.039474
air0.038462
rhizosphere0.037736
trachea0.036810
tracheal aspirate0.036474
greenhouse0.036474
bio-organic fertilizer0.036474
pomacea canaliculata0.036145
golden apple snail0.036145
nanheng river0.036145
qingpu district0.036145
sputum0.036145
sinusitis0.036145
pellet feed diet0.036145
nephrolithiasis0.036145
oropharynx0.036145
respiratory failure0.036145
acute respiratory failure0.036145
uganda0.036145
pneumonia0.036145
agave deserti0.036145
irrigated0.036145
costa rica0.035928
diabetes mellitus0.035503
site a0.035503
whole body0.034884
state of alabama0.034884
usa0.034286
bronchial epithelium0.034286
city0.033520
LOWER IN feces0.033333
commonwealth of pennsylvania0.033149
pig0.033149
italy0.032609
hiv infection0.032086
crohn's disease0.031088
control0.027682
parkinson's disease0.024691
nectar0.024540
protected brush sampling0.024390
tick0.024390
outdoor0.024390
castor bean tick0.024390
indoor0.024390
office0.024390
wound0.024390
ulcer0.024390
finch0.024390
location 50.024390
location 30.024390
tooth0.024390
location 40.024390
Fraction of dbbact annotations with this term covered by the query
TermScore
parkinson's disease1.000000
trachea1.000000
sinusoidal space0.666667
paranasal sinus0.666667
cystic fibrosis0.666667
tap water0.666667
tracheal aspirate0.666667
nectar0.666667
greenhouse0.666667
bio-organic fertilizer0.666667
LOWER IN sinusitis0.500000
protected brush sampling0.500000
mild disease course0.500000
state of new hampshire0.500000
bronchoalveolar lavage0.500000
haemaphysalis humerosa0.500000
tick0.500000
pomacea canaliculata0.500000
golden apple snail0.500000
nanheng river0.500000
qingpu district0.500000
LOWER IN buccal mass0.500000
outdoor0.500000
castor bean tick0.500000
indoor0.500000
office0.500000
perth0.500000
recurrent otitis media0.500000
middle ear fluid0.500000
sputum0.500000
wound0.500000
ulcer0.500000
sinusitis0.500000
finch0.500000
camarhynchus parvulus0.500000
small tree finch0.500000
spring water0.500000
location 50.500000
location 30.500000
drinking water0.500000
pellet feed diet0.500000
ram's horn snail0.500000
planorbella trivolvis0.500000
tooth0.500000
geospiza fuliginosa0.500000
small ground finch0.500000
location 40.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
respiratory technology dependent0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
LOWER IN defatted larvae insect diet0.500000
tucson0.500000
oropharynx0.500000
oropharyngeal swab0.500000
respiratory failure0.500000
acute respiratory failure0.500000
endotracheal aspirate0.500000
LOWER IN larvae insect diet0.500000
LOWER IN alfalfa diet0.500000
LOWER IN pre pupae insect diet0.500000
uganda0.500000
pneumonia0.500000
breast milk material0.500000
indonesia0.500000
municipality of yogyakarta0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root interior0.500000
turtle farm0.500000
red-eared slider turtle0.500000
trachemys scripta elegans0.500000
age 0 days0.500000
neonate stage0.500000
age < 3 months0.500000
gut content0.500000
12c0.500000
cold environment0.500000
wheat bran0.500000
ulcerative colitis0.500000
induced sputum0.500000
LOWER IN bronchial brush0.500000
LOWER IN bronchus0.500000
LOWER IN bronchial epithelium0.500000
ixodes scapularis0.500000
pixr immunized0.500000
stachytarpheta frantzii0.500000
purple porterweed0.500000
distribution system0.500000
LOWER IN water treatment plant0.500000
LOWER IN ceftriaxone0.500000
no ceftriaxone0.500000
agave0.500000
agave deserti0.500000
maojian district0.500000
age 3 years0.500000
chinese giant salamander0.500000
andrias davidianus0.500000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.375000
united states of america0.318750
adult0.225000
china0.212500
feces0.162500
water0.137500
research facility0.125000
drinking water0.068750
lung0.056250
state of california0.056250
state of florida0.056250
fresh water0.056250
israel0.056250
soil0.056250
intestine0.050000
spring water0.050000
digestive system0.050000
LOWER IN control0.050000
cystic fibrosis0.043750
australia0.043750
sinusoidal space0.037500
paranasal sinus0.037500
mild disease course0.037500
state of new hampshire0.037500
bronchoalveolar lavage0.037500
skin0.037500
fish0.037500
oncorhynchus mykiss0.037500
rainbow trout0.037500
sweden0.037500
farm0.037500
leaf0.037500
mucosa0.031250
stomach0.031250
control0.031250
hospital0.031250
sea water0.031250
mucus0.025000
air0.025000
child0.025000
foot0.025000
ram's horn snail0.025000
planorbella trivolvis0.025000
tap water0.025000
brazil0.025000
age 50-60 years0.025000
nanning city prefecture0.025000
fishmeal diet0.025000
agave0.025000
desert0.025000
sus scrofa0.025000
rhizosphere0.025000
whole body0.018750
pomacea canaliculata0.018750
golden apple snail0.018750
nanheng river0.018750
qingpu district0.018750
sputum0.018750
diabetes mellitus0.018750
state of alabama0.018750
sinusitis0.018750
usa0.018750
site a0.018750
pellet feed diet0.018750
nephrolithiasis0.018750
crohn's disease0.018750
trachea0.018750
tracheal aspirate0.018750
oropharynx0.018750
commonwealth of pennsylvania0.018750
respiratory failure0.018750
acute respiratory failure0.018750
hiv infection0.018750
uganda0.018750
bronchial epithelium0.018750
pneumonia0.018750
costa rica0.018750
agave deserti0.018750
city0.018750
greenhouse0.018750
irrigated0.018750
pig0.018750
italy0.018750
LOWER IN feces0.018750
bio-organic fertilizer0.018750
protected brush sampling0.012500
tick0.012500
body proper0.012500
contamination0.012500
outdoor0.012500
ixodes ricinus0.012500
castor bean tick0.012500
switzerland0.012500
indoor0.012500
office0.012500
wound0.012500
ulcer0.012500
parkinson's disease0.012500
galapagos islands0.012500
bird0.012500
Exp. ID User ID Description Date Region Flag Sequences
228amnonhigh in sinus brush of CF patients compared to other sinusitis ( high in cystic fibrosis compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / -7
646amnondominant protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / -2
646amnoncommon lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / -1
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 0
621amnondominant haemaphysalis humerosa, tick, body proper, whole body, australia2020-05-07v1No1 / 1
646amnoncommon protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 2
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 2
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 3
585amnon high in stomach intestine compared to buccal mass in china pomacea canaliculata golden apple snail nanheng river qingpu district 2020-02-02v3No1 / 3
460amnonhigh freq. in outdoor air (dominant air, united states of america, state of california, outdoor)2019-01-12v4No1 / 4
595amnondominant ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 4
460amnonhigh freq. in occupied office air (dominant air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 5
605amnondominant australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v3No1 / 5
646amnondominant adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 6
232amnoncommon in foot ulcer of diabetic patients (common homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 6
232amnonhigh freq. in foot ulcer of diabetic patients (dominant homo sapiens, skin, australia, foot, wound, ulcer, diabetes mellitus)2017-11-05v4No1 / 6
651amnondominant parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 7
651amnondominant control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 7
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 7
440amnondominant galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 7
612amnondominant state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 7
229amnonhigh freq. in sinuses from chronic rhinosinositis patients (dominant homo sapiens, paranasal sinus, sinusoidal space, australia, sinusitis)2017-10-31v4No1 / 8
612amnondominant state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 8
109amnondominant usa, water, drinking water, site a2017-04-08v4No1 / 9
460amnoncommon in occupied office air (common air, united states of america, state of california, indoor, office)2019-01-12v4No1 / 9
741amnondominant pellet feed diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 9
662amnondominant tap water, drinking water, water, israel2020-09-20v3No1 / 9
95amnonhigh freq. in root canal (dominant homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 10
440amnondominant galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 10
612amnondominant state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 11
286amnonhigh freq. in feces of individuals with kidney stones (dominant homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 12
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 12
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 12
392amnon high in fishmeal diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 13
460amnoncommon in outdoor air (common air, united states of america, state of california, outdoor)2019-01-12v4No1 / 13
591amnondominant homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 13
677amnondominant palatine tonsil, south korea, adult, tonsil, homo sapiens2028-03-01v3No1 / 13
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 15
636amnondominant oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 15
636amnondominant hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 15
392amnon high in fishmeal diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 15
741amnon high in pellet feed diet compared to alfalfa diet in intestine ram's horn snail china research facility planorbella trivolvis 2021-02-17v3No1 / 15
392amnon high in fishmeal diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 16
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 17
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 19
723amnondominant adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 19
710amnonsuspected contaminant (common in blanks) (contamination)2028-05-20v4No1 / 21
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 21
590amnoncommon china, turtle farm, farm, hainan autonomous prefecture, intestine, red-eared slider turtle, trachemys scripta elegans, age 0 days, neonate stage2020-02-10v4No1 / 21
233amnon high in age age < 3 months compared to age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 23
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 23
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 24
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 24
354amnon high in sputum induced sputum compared to bronchial brush bronchus bronchial epithelium in homo sapiens united states of america adult 2018-07-30v4No1 / 24
646amnoncommon adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 25
354amnon high in saliva oral wash compared to bronchial epithelium bronchial brush bronchus in homo sapiens united states of america adult 2018-07-30v4No1 / 25
723amnoncommon adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 26
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 27
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 27
228amnoncommon in sinus brush of healthy participants (common homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america)2017-10-31v4No1 / 28
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 28
741amnoncommon pellet feed diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 28
232amnoncommon in foot of diabetic patients (common homo sapiens, skin, australia, foot, diabetes mellitus)2017-11-05v4No1 / 29
501amnoncommon costa rica, flower, nectar, stachytarpheta frantzii, purple porterweed2019-03-08v4No1 / 32
109amnon high in distribution system compared to water treatment plant in usa water drinking water site a 2017-04-08v4No1 / 33
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 33
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 34
595amnoncommon ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 34
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 39
360amnoncommon agave, agave deserti, leaf, leaf endosphere, desert, state of california2018-08-20v4No1 / 40
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 41
651amnon high in control compared to parkinson's disease in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 44
360amnoncommon agave, desert, root endosphere, agave deserti, state of california, root2018-08-21v4No1 / 44
661amnoncommon lung, farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus2020-09-20v4No1 / 45
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 45
109amnoncommon usa, water, drinking water, site a2017-04-08v4No1 / 46
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 46
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 47
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 47
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 49
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 49
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 53
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 53
549amnoncommon acropora cervicornis, coral, puerto rico, isla palominos2019-08-17v4No1 / 54
9amnonhigher in beginning of experiment comapred to 12 days ( high in beginning compared to end in bermuda sea water )2016-10-27v4No1 / 63
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 63
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult canada toronto age 20-30 years 2020-09-13v3No1 / 64
361amnoncommon leaf, austria, greenhouse, plant, musa paradisiaca2018-08-21v4No1 / 69
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 69
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 69
109amnoncommon water, drinking water, united states of america, site e2017-04-08v4No1 / 72
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 73
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 73
663amnoncommon lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 76
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 78
662amnon high in drinking water tap water compared to treated wastewater wastewater treatment plant in water israel 2020-09-20v3No1 / 81
662amnoncommon tap water, drinking water, water, israel2020-09-20v3No1 / 81
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 92
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 102
109amnon high in water treatment plant compared to distribution system in water drinking water united states of america site d 2017-04-08v4No1 / 103
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 105
691amnon high in spring compared to summer in commune of paris french republic water drinking water 2028-03-11v3No1 / 108
636amnon high in oropharynx oropharyngeal swab compared to trachea endotracheal aspirate tracheal aspirate in hospital commonwealth of pennsylvania united states of america respiratory failure acute respiratory failure adult homo sapiens 2020-08-08v4No1 / 114
711amnon high in adult compared to age 8-12 years child in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v4No1 / 126
109amnon high in distribution system compared to water treatment plant in water drinking water united states of america site e 2017-04-08v4No1 / 135
662amnon high in irrigated compared to dry in neve yaar depth 0-10cm soil agricultural field israel 2020-09-21v3No1 / 138
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 139
222amnoncommon on outer biofilm on metal plate in ocean water (common water, sea water, guinea, depth 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v4No1 / 139
741amnoncommon alfalfa diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 141
615amnon high in stem endosphere upper stem stem compared to leaf endosphere leaf in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 145
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 154
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 158
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 186
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 187
744amnon high in caecum compared to cloaca in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 187
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 202
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 206
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 231
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 232
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v4No1 / 233
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 235
666amnoncommon south american tapir, tapirus terrestris, italy, feces2020-09-25v3No1 / 235
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 237
282amnoncommon soil, mangrove swamp, mangrove, united states of america, state of florida, avicennia germinans, rhizophora mangle2018-01-25v4No1 / 251
602sheryohigher in rhizoshere of tomato plant roots planted in potting mix amended with biochar ( high in amended with biochar compared to unamended in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 262
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 273
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 280
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 298
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in age 20-30 years toronto canada adult homo sapiens 2020-09-13v3No1 / 298
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 311
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in water drinking water united states of america tap water state of illinois )2018-05-28v4No1 / 357
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 371
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 375
342amnoncommon water, pacific ocean, philippine sea, depth 150m, sea water2018-05-28v4No1 / 389
263amnonhigher in heat stressed soil (65C) compared to control ( high in heat stressed soil compared to control in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 394
662amnoncommon clay soil, irrigated, neve yaar, depth 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 394
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 32020-04-22v4No1 / 412
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 415
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 451
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 463
662amnoncommon water, wastewater treatment plant, treated wastewater, israel2020-09-20v3No1 / 465
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 476
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 509
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 12020-04-22v4No1 / 510
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 524
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 530
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 537
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 569
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 588
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 614
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 637
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 641
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 647
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 673
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 701
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 742
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 875
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common dazomet, soil fumigation, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county, bio-organic fertilizer, compost biofilter, paenibacillus polymyxa, paenibacillus, compost soil, pig manure, conventional tillage, deep plough)2021-04-18v4No1 / 1109
4amnoncommon periplaneta americana, digestive system, united states of america2016-10-13v4No1 / 1629

Problems / suggestions? Please email info AT dbbact DOT org