Search result for sequence:
TACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTCGTTTAAGTCCGTTGTGAAAGCCCTGGGCTCAACCTGGGAACTGCAGTGGATACTGGACGACTAGAGTGTGGTAGAGGGTAGCGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
cow milk (raw)0.156250
cow milk (fluid)0.156250
milk0.156250
tobacco0.156250
cigar0.156250
nicotiana tabacum0.144928
mild disease course0.129032
state of new hampshire0.129032
lowland pasture0.129032
lowland farm0.129032
cystic fibrosis0.121212
mucus0.097561
foodon product type0.097561
skin0.094118
stomach0.093023
lung0.088889
digestive system0.087591
south korea0.085106
sweden0.083333
fish0.080000
adult0.076586
italy0.074627
homo sapiens0.073260
protected brush sampling0.068966
anas platyrhynchos0.068966
mallard0.068966
ice0.068966
mucosa of stomach0.068966
swisher sweets original cigar0.068966
swisher sweets sweet cherry cigar0.068966
north america0.068966
respiratory airway0.068966
exhaled air condensate0.068966
whale blow0.068966
pond0.068966
LOWER IN plectostoma concinnum0.068966
LOWER IN opisthostoma concinnum0.068966
land snail0.068966
state of sabah0.068966
greenhouse0.066667
megaptera novaeangliae0.066667
humpback whale0.066667
malaysia0.066667
commonwealth of pennsylvania0.065574
mouth mucosa0.064516
whole body0.064516
glacier0.064516
frog0.064516
body proper0.062500
hospital0.062500
bronchoalveolar lavage0.060606
united states of america0.059641
biopsy0.058824
austria0.058824
gastrointestinal system0.058824
cloaca0.057143
plant0.057143
pacific ocean0.055556
female0.053097
farm0.045662
china0.044643
brazil0.043478
leaf0.042553
intestine0.040816
state of california0.040000
blood0.035714
bangkok0.035714
semi domestic dog0.035714
LOWER IN june0.035714
october0.035714
reagent0.035714
LOWER IN days 0-30.035714
days 57-600.035714
harvard forest0.035714
plant fluid0.035714
pitcher fluid0.035714
pitcher plant0.035714
sarracenia purpurea0.035714
skin of body0.035714
fermented vegetable food product0.035714
influenza0.035714
spices0.035714
spice or herb0.035714
age 25-50 years0.035714
midwest region0.035714
melopsittacus undulatus0.035714
parakeet0.035714
pet0.035714
drosophila melanogaster0.035714
fruit fly0.035714
biting midge0.035714
culicoides foxi0.035714
culicoides <genus>0.035714
depth 20-100cm0.035714
subsurface0.035714
amphibia0.035714
oophaga pumilio0.035714
strawberry poison frog0.035714
beaucarnea recurvata0.035714
middle timepoint0.035714
Fraction of dbbact annotations with this term covered by the query
TermScore
blood0.500000
bangkok0.500000
semi domestic dog0.500000
protected brush sampling0.500000
mild disease course0.500000
state of new hampshire0.500000
lowland pasture0.500000
lowland farm0.500000
cow milk (raw)0.500000
cow milk (fluid)0.500000
milk0.500000
LOWER IN june0.500000
october0.500000
reagent0.500000
LOWER IN days 0-30.500000
days 57-600.500000
harvard forest0.500000
plant fluid0.500000
pitcher fluid0.500000
pitcher plant0.500000
sarracenia purpurea0.500000
skin of body0.500000
fermented vegetable food product0.500000
anas platyrhynchos0.500000
mallard0.500000
influenza0.500000
spices0.500000
spice or herb0.500000
age 25-50 years0.500000
midwest region0.500000
melopsittacus undulatus0.500000
parakeet0.500000
pet0.500000
drosophila melanogaster0.500000
fruit fly0.500000
biting midge0.500000
culicoides foxi0.500000
culicoides <genus>0.500000
depth 20-100cm0.500000
subsurface0.500000
ice0.500000
amphibia0.500000
oophaga pumilio0.500000
strawberry poison frog0.500000
mucosa of stomach0.500000
beaucarnea recurvata0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
waste water0.500000
xinxiang city prefecture0.500000
epidermis0.500000
chub mackerel0.500000
scomber japonicus0.500000
san diego0.500000
LOWER IN trachea0.500000
LOWER IN endotracheal aspirate0.500000
LOWER IN tracheal aspirate0.500000
oropharyngeal swab0.500000
respiratory failure0.500000
acute respiratory failure0.500000
cheyenne menthol box cigar0.500000
tobacco0.500000
cigar0.500000
swisher sweets original cigar0.500000
cheyenne full flavor cigar0.500000
alpine pasture0.500000
alpine0.500000
dracaena draco0.500000
swisher sweets sweet cherry cigar0.500000
lapland0.500000
north america0.500000
respiratory airway0.500000
exhaled air condensate0.500000
whale blow0.500000
pond0.500000
astyanax paranae0.500000
astyanax0.500000
poecilia reticulata0.500000
guppy0.500000
LOWER IN ocean0.500000
LOWER IN depth 25cm0.500000
LOWER IN alpine pasture0.500000
LOWER IN alpine0.500000
new delhi0.500000
LOWER IN plectostoma concinnum0.500000
LOWER IN opisthostoma concinnum0.500000
georissa0.500000
georissa similis0.500000
land snail0.500000
state of sabah0.500000
LOWER IN cheyenne full flavor cigar0.500000
LOWER IN cheyenne menthol box cigar0.500000
brackish water0.500000
caspian sea0.500000
sample depth 12-35cm0.500000
alycaeus jagori0.500000
foodon product type0.400000
cystic fibrosis0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.277778
united states of america0.203704
adult0.185185
farm0.092593
italy0.092593
cow milk (raw)0.092593
cow milk (fluid)0.092593
milk0.092593
china0.092593
tobacco0.092593
nicotiana tabacum0.092593
cigar0.092593
lung0.074074
mucus0.074074
mild disease course0.074074
cystic fibrosis0.074074
state of new hampshire0.074074
lowland pasture0.074074
lowland farm0.074074
skin0.074074
digestive system0.074074
stomach0.074074
contamination0.055556
research facility0.055556
south korea0.055556
foodon product type0.055556
feces0.055556
female0.055556
sweden0.055556
fish0.055556
protected brush sampling0.037037
bronchoalveolar lavage0.037037
mouth mucosa0.037037
commonwealth of pennsylvania0.037037
anas platyrhynchos0.037037
mallard0.037037
state of california0.037037
cloaca0.037037
whole body0.037037
body proper0.037037
ice0.037037
glacier0.037037
frog0.037037
mucosa of stomach0.037037
biopsy0.037037
leaf0.037037
austria0.037037
greenhouse0.037037
plant0.037037
hospital0.037037
pacific ocean0.037037
swisher sweets original cigar0.037037
swisher sweets sweet cherry cigar0.037037
north america0.037037
megaptera novaeangliae0.037037
humpback whale0.037037
respiratory airway0.037037
exhaled air condensate0.037037
whale blow0.037037
brazil0.037037
pond0.037037
intestine0.037037
LOWER IN plectostoma concinnum0.037037
LOWER IN opisthostoma concinnum0.037037
land snail0.037037
gastrointestinal system0.037037
malaysia0.037037
state of sabah0.037037
blood0.018519
dog0.018519
canis lupus familiaris0.018519
thailand0.018519
bangkok0.018519
semi domestic dog0.018519
LOWER IN june0.018519
LOWER IN spring0.018519
october0.018519
autumn0.018519
oral cavity0.018519
australia0.018519
water0.018519
reagent0.018519
LOWER IN wild0.018519
LOWER IN days 0-30.018519
LOWER IN early time points0.018519
days 57-600.018519
late time points0.018519
harvard forest0.018519
plant fluid0.018519
pitcher fluid0.018519
commonwealth of massachusetts0.018519
pitcher plant0.018519
sarracenia purpurea0.018519
skin of body0.018519
umbilicus0.018519
fermented vegetable food product0.018519
kimchi0.018519
LOWER IN control0.018519
influenza0.018519
spices0.018519
Exp. ID User ID Description Date Region Flag Sequences
664amnoncandidate contaminant in low biomass blood samples (contamination)2020-09-23v4No1 / -5
646amnondominant protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / -2
646amnoncommon lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / -1
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 0
646amnoncommon protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 2
617amnondominant lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 3
617amnon high in october autumn compared to june spring in lowland pasture lowland farm farm italy cow milk (raw) cow milk (fluid) milk 2020-05-03v3No1 / 6
685amnondominant oral cavity, mouth mucosa, australia, adult, homo sapiens2028-03-08v3No1 / 8
588amnonreagent contaminant (contamination)2020-02-10v3No1 / 11
614amnonincreases in picher plant fluid grown in lab ( high in research facility days 57-60 late time points compared to wild days 0-3 early time points in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 12
623amnondominant skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 15
705amnoncommon south korea, fermented vegetable food product, kimchi2028-04-04v3No1 / 19
81amnoncommon anas platyrhynchos, mallard, state of california, cloaca2017-03-05v4No1 / 22
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 29
74amnoncommon spices, united states of america, foodon product type, spice or herb2017-02-27v4No1 / 31
745amnon high in age 25-50 years compared to age 50-80 years in adult midwest region united states of america feces homo sapiens 2021-02-25v3No1 / 32
302amnoncommon in feces of parakeet pet birds (common bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 36
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 37
674amnoncommon biting midge, culicoides foxi, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 42
763amnon high in depth 20-100cm subsurface compared to depth 0-20cm surface in filtered 0.2um ice glacier sweden 2021-04-10v3No1 / 42
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 53
771amnoncommon body proper, whole body, china, cotton aphid, aphis gossypii2021-04-21v3No1 / 54
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 69
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 73
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 75
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 75
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v3No1 / 77
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 78
642amnon high in skin epidermis compared to gill in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 92
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 105
636amnon high in oropharynx oropharyngeal swab compared to trachea endotracheal aspirate tracheal aspirate in hospital commonwealth of pennsylvania united states of america respiratory failure acute respiratory failure adult homo sapiens 2020-08-08v4No1 / 114
758amnoncommon in cigar tobacco (common cheyenne menthol box cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 115
758amnoncommon in cigar tobacco (common swisher sweets original cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 127
758amnoncommon in cigar tobacco (common cheyenne full flavor cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 128
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 129
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 131
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 133
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 147
758amnoncommon in cigar tobacco (common swisher sweets sweet cherry cigar, tobacco, nicotiana tabacum, cigar)2021-03-28v3No1 / 154
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 193
511amnoncommon snow, depth 0-5cm, lapland, finland, sweden, kingdom of norway2019-03-20v4No1 / 205
209amnon high in pacific ocean compared to atlantic ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 211
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 249
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 265
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 300
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 320
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 351
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 476
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 537
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 569
758amnon high in swisher sweets sweet cherry cigar swisher sweets original cigar compared to cheyenne full flavor cigar cheyenne menthol box cigar in tobacco nicotiana tabacum cigar 2021-03-28v3No1 / 710
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1651
696amnon high in alycaeus jagori compared to opisthostoma concinnum plectostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 1665

Problems / suggestions? Please email info AT dbbact DOT org