Search result for sequence:
TACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTCGTTTAAGTCCGTTGTGAAAGCCCTGGGCTCAACCTGGGAACTGCAGTGGATACTGGGCGACTAGAGTGTGGTAGAGGGTAGCGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
rhizosphere0.181721
china0.171450
united states of america0.151571
skin0.139942
brazil0.138801
soil0.122867
wheat0.120805
homo sapiens0.113956
depth 0-20cm0.110769
fresh water0.108959
intestine0.107784
leaf0.107784
research facility0.105332
water0.104976
LOWER IN soil0.096552
north china plain0.083916
mucus0.080537
cultivated environment0.077419
agricultural feature0.077419
mexico0.072860
canada0.072202
greenhouse0.072202
state of rhode island0.070922
foodon product type0.069686
state of tennessee0.069686
digestive system0.069364
river0.066225
larval stage0.065502
root0.059347
brackish water0.057554
caspian sea0.057554
tomato0.057554
cannabis sativa0.057554
pond0.057554
populus0.057554
food (fermented)0.056471
duodenum0.055944
farm0.055814
root endosphere0.054422
winter0.054299
united kingdom0.053691
commonwealth of virginia0.052980
solanum lycopersicum0.052980
tree0.052980
stomach0.050314
state of florida0.049689
state of california0.047337
child0.045198
ixodes scapularis0.043796
tracheal aspirate0.043796
respiratory technology dependent0.043796
state of alabama0.043796
jiulong river0.043796
fujian province0.043796
spring water0.043796
adult0.043668
frog0.043478
tick0.042857
trachea0.042857
channel catfish0.042857
ictalurus punctatus0.042857
depth 0.5m0.042857
soybean0.042857
marine sediment0.042781
stem0.042403
desert0.042403
LOWER IN root0.042254
glycine max0.041958
triticum aestivum0.041096
LOWER IN feces0.040816
austria0.040268
fish0.039867
LOWER IN winter0.039474
body proper0.038710
plant0.038710
sus scrofa0.037975
pig0.037975
summer0.037975
sediment0.035874
stream0.029851
depth 150-600m0.029630
sample depth 0-12cm0.029630
sample depth 12-35cm0.029630
notophthalmus viridescens0.029630
mucosa0.029630
wheat bran0.029630
pulpitis0.029630
early flowering stage0.029630
turtle farm0.029630
red pepper sauce0.029630
liolaemus ruibali0.029630
small intestine0.029630
mucosa of stomach0.029630
LOWER IN late timepoint0.029630
LOWER IN pond0.029630
campinas0.029630
depth 10 cm0.029630
maryland county0.029630
arachis hypogaea0.029630
peanut0.029630
Fraction of dbbact annotations with this term covered by the query
TermScore
mexico0.800000
canada0.666667
greenhouse0.666667
stream0.666667
brackish water0.500000
caspian sea0.500000
depth 150-600m0.500000
sample depth 0-12cm0.500000
ixodes scapularis0.500000
sample depth 12-35cm0.500000
tracheal aspirate0.500000
respiratory technology dependent0.500000
lower respiratory tract disease0.500000
notophthalmus viridescens0.500000
mucosa0.500000
state of alabama0.500000
tomato0.500000
wheat bran0.500000
LOWER IN days 0-30.500000
days 57-600.500000
harvard forest0.500000
plant fluid0.500000
pitcher fluid0.500000
pitcher plant0.500000
sarracenia purpurea0.500000
pulpitis0.500000
LOWER IN pixr immunized0.500000
skin of body0.500000
umbilicus0.500000
early flowering stage0.500000
cannabis sativa0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root interior0.500000
turtle farm0.500000
red-eared slider turtle0.500000
trachemys scripta elegans0.500000
age 0 days0.500000
neonate stage0.500000
xylella fastidiosa temecula10.500000
pierce disease0.500000
tooth0.500000
red pepper sauce0.500000
high salt concentration0.500000
LOWER IN low salt concentration0.500000
drosophila melanogaster0.500000
fruit fly0.500000
uganda0.500000
LOWER IN ceftriaxone0.500000
no ceftriaxone0.500000
pneumonia0.500000
LOWER IN intestinal contents0.500000
nicotiana galuca0.500000
amphibia0.500000
oophaga pumilio0.500000
strawberry poison frog0.500000
state of rhode island0.500000
kimchi0.500000
LOWER IN days 1-90.500000
pet0.500000
nymphicus hollandicus0.500000
cockatiel0.500000
liolaemus ruibali0.500000
small intestine0.500000
musa paradisiaca0.500000
mucosa of stomach0.500000
helicobacter pylori infectious disease0.500000
LOWER IN acute respiratory illness0.500000
beaucarnea recurvata0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
LOWER IN late timepoint0.500000
cabbage0.500000
bronchial brush0.500000
LOWER IN oral wash0.500000
rhinella icterica0.500000
yellow cururu toad0.500000
zea mays subsp. mays0.500000
corn0.500000
fire salamander0.500000
LOWER IN pond0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 1-150.500000
aerobic fermentation0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
scallion0.500000
stem surface0.500000
upper stem0.500000
exosphere0.500000
campinas0.500000
kitchen0.500000
sink0.500000
skh-1 hairless mouse0.500000
dorsum0.500000
shenzhen city prefecture0.500000
dracaena draco0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.312977
china0.244275
homo sapiens0.160305
soil0.137405
rhizosphere0.129771
research facility0.122137
skin0.091603
brazil0.083969
water0.083969
intestine0.068702
leaf0.068702
fresh water0.068702
depth 0-20cm0.068702
wheat0.068702
LOWER IN soil0.053435
mucus0.045802
farm0.045802
digestive system0.045802
cultivated environment0.045802
north china plain0.045802
agricultural feature0.045802
winter0.045802
larval stage0.038168
adult0.038168
canada0.038168
root0.038168
mexico0.038168
state of rhode island0.038168
greenhouse0.038168
foodon product type0.038168
river0.038168
state of tennessee0.038168
marine sediment0.030534
brackish water0.030534
sediment0.030534
caspian sea0.030534
child0.030534
commonwealth of virginia0.030534
solanum lycopersicum0.030534
tomato0.030534
root endosphere0.030534
cannabis sativa0.030534
state of california0.030534
food (fermented)0.030534
united kingdom0.030534
stomach0.030534
pond0.030534
state of florida0.030534
duodenum0.030534
populus0.030534
tree0.030534
tick0.022901
ixodes scapularis0.022901
body proper0.022901
trachea0.022901
tracheal aspirate0.022901
respiratory technology dependent0.022901
LOWER IN control0.022901
state of alabama0.022901
channel catfish0.022901
ictalurus punctatus0.022901
control0.022901
stem0.022901
sus scrofa0.022901
pig0.022901
frog0.022901
feces0.022901
LOWER IN feces0.022901
austria0.022901
plant0.022901
fish0.022901
desert0.022901
depth 0.5m0.022901
jiulong river0.022901
fujian province0.022901
spring water0.022901
summer0.022901
LOWER IN winter0.022901
glycine max0.022901
soybean0.022901
triticum aestivum0.022901
LOWER IN root0.022901
depth 150-600m0.015267
sample depth 0-12cm0.015267
depth 200m0.015267
sample depth 12-35cm0.015267
notophthalmus viridescens0.015267
newt0.015267
mucosa0.015267
botanical fruit food product0.015267
wheat bran0.015267
dentition0.015267
pulpitis0.015267
mouth0.015267
early flowering stage0.015267
turtle farm0.015267
hainan autonomous prefecture0.015267
grape0.015267
vitis vinifera0.015267
endosphere0.015267
Exp. ID User ID Description Date Region Flag Sequences
141amnondominant marine sediment, brackish water, sediment, caspian sea, depth 150-600m, sample depth 0-12cm2017-04-18v4No1 / 5
262amnondominant tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 8
141amnondominant marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 11
468amnonlower in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in lower respiratory tract disease compared to control in homo sapiens united states of america child trachea tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 13
99amnondominant commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 15
481amnondominant united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 17
146amnondominant united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 19
165amnonhigh freq. in moist wheat bran (dominant research facility, wheat bran, china)2017-07-16v4No1 / 19
614amnonincreases in picher plant fluid grown in lab ( high in research facility days 57-60 late time points compared to wild days 0-3 early time points in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 20
105amnondominant brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 20
262amnonlower in tick larvae fed on PIXR immunized mice compared to non immunized ( high in control compared to pixr immunized in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
623amnondominant skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 23
618amnondominant early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 24
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
590amnoncommon china, turtle farm, farm, hainan autonomous prefecture, intestine, red-eared slider turtle, trachemys scripta elegans, age 0 days, neonate stage2020-02-10v4No1 / 29
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 50
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 74
361amnoncommon leaf, austria, greenhouse, plant, musa paradisiaca2018-08-21v4No1 / 77
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 77
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v3No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 127
615amnoncommon stem surface, upper stem, stem, exosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 129
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
618amnoncommon early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 205
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 243
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-19v4No1 / 333
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
618amnoncommon late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 352
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 52020-04-22v4No1 / 383
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
259amnonlower in manured soil compared to non-manured ( high in non-manured soil compared to manured soil in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 397
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
618amnon high in root endosphere root compared to rhizosphere in canada farm cannabis sativa 2020-05-04v4No1 / 510
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 22020-04-22v4No1 / 596
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
612amnoncommon state of florida, united states of america, spring water, water, fresh water, location 42020-04-22v4No1 / 655
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
454amnon high in summer compared to winter in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 791
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 150-600m, sample depth 0-12cm2017-04-18v4No1 / 1549
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org