Search result for sequence:
TACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTCGTTTAAGTCCGTTGTGAAAGCCCTGGGCTCAACCTGGGAACTGCAGTGGATACTGGGCGACTAGAGTGTGGTAGAGGGTAGCGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
china0.177966
rhizosphere0.173643
skin0.145009
united states of america0.141765
wheat0.141176
depth 0-20cm0.136364
brazil0.129310
soil0.128000
leaf0.121457
homo sapiens0.113976
research facility0.108827
intestine0.108108
north china plain0.095238
LOWER IN soil0.094340
mucus0.090909
cultivated environment0.086957
agricultural feature0.086957
fresh water0.085106
mexico0.083160
state of rhode island0.080645
foodon product type0.079051
state of tennessee0.079051
water0.078475
digestive system0.077670
river0.074627
larval stage0.073710
brackish water0.065574
caspian sea0.065574
tomato0.065574
populus0.065574
food (fermented)0.064171
duodenum0.063492
solanum lycopersicum0.061538
united kingdom0.060606
commonwealth of virginia0.059701
tree0.059701
winter0.058824
pond0.056338
state of california0.052632
child0.051948
tick0.050000
ixodes scapularis0.050000
tracheal aspirate0.050000
respiratory technology dependent0.050000
state of alabama0.050000
greenhouse0.050000
jiulong river0.050000
fujian province0.050000
frog0.049587
trachea0.048780
channel catfish0.048780
ictalurus punctatus0.048780
depth 0.5m0.048780
soybean0.048780
LOWER IN root0.048780
desert0.048193
marine sediment0.048193
glycine max0.047619
triticum aestivum0.047619
LOWER IN feces0.046512
fish0.045977
austria0.045455
body proper0.044444
LOWER IN winter0.044444
plant0.043478
summer0.043011
sus scrofa0.042553
pig0.042553
adult0.041885
sediment0.038835
stream0.034188
depth 150-600m0.033898
sample depth 0-12cm0.033898
sample depth 12-35cm0.033898
notophthalmus viridescens0.033898
mucosa0.033898
wheat bran0.033898
pulpitis0.033898
endosphere0.033898
red pepper sauce0.033898
liolaemus ruibali0.033898
small intestine0.033898
LOWER IN late timepoint0.033898
LOWER IN pond0.033898
depth 10 cm0.033898
maryland county0.033898
arachis hypogaea0.033898
peanut0.033898
orchard0.033898
agave0.033898
bulk soil0.033898
bronchial epithelium0.033613
newt0.033333
grape0.033333
vitis vinifera0.033333
capsicum annuum0.033333
argentina0.033333
jejunum0.033333
citrus0.033333
ph 60.033333
Fraction of dbbact annotations with this term covered by the query
TermScore
mexico0.800000
stream0.666667
wheat0.666667
brackish water0.500000
caspian sea0.500000
depth 150-600m0.500000
sample depth 0-12cm0.500000
tick0.500000
ixodes scapularis0.500000
sample depth 12-35cm0.500000
tracheal aspirate0.500000
respiratory technology dependent0.500000
lower respiratory tract disease0.500000
notophthalmus viridescens0.500000
mucosa0.500000
state of alabama0.500000
tomato0.500000
wheat bran0.500000
pulpitis0.500000
LOWER IN pixr immunized0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root interior0.500000
endosphere0.500000
xylella fastidiosa temecula10.500000
pierce disease0.500000
tooth0.500000
red pepper sauce0.500000
high salt concentration0.500000
LOWER IN low salt concentration0.500000
drosophila melanogaster0.500000
fruit fly0.500000
uganda0.500000
LOWER IN ceftriaxone0.500000
no ceftriaxone0.500000
pneumonia0.500000
LOWER IN intestinal contents0.500000
nicotiana galuca0.500000
amphibia0.500000
oophaga pumilio0.500000
strawberry poison frog0.500000
state of rhode island0.500000
kimchi0.500000
LOWER IN days 1-90.500000
pet0.500000
nymphicus hollandicus0.500000
cockatiel0.500000
liolaemus ruibali0.500000
small intestine0.500000
greenhouse0.500000
musa paradisiaca0.500000
LOWER IN acute respiratory illness0.500000
beaucarnea recurvata0.500000
middle timepoint0.500000
two weeks0.500000
LOWER IN fresh0.500000
LOWER IN food spoilage0.500000
LOWER IN late timepoint0.500000
cabbage0.500000
bronchial brush0.500000
LOWER IN oral wash0.500000
rhinella icterica0.500000
yellow cururu toad0.500000
zea mays subsp. mays0.500000
corn0.500000
fire salamander0.500000
LOWER IN pond0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 1-150.500000
aerobic fermentation0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
scallion0.500000
kitchen0.500000
sink0.500000
skh-1 hairless mouse0.500000
dorsum0.500000
shenzhen city prefecture0.500000
dracaena draco0.500000
bangladesh0.500000
depth 10 cm0.500000
koshi river0.500000
scinax fuscovarius0.500000
ginger0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
drosophila0.500000
fly0.500000
drosophila nigrospiracula0.500000
LOWER IN cactus0.500000
LOWER IN decaying0.500000
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
astyanax paranae0.500000
astyanax0.500000
maryland county0.500000
poecilia reticulata0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.315789
china0.245614
homo sapiens0.157895
soil0.140351
research facility0.131579
rhizosphere0.122807
skin0.096491
brazil0.078947
leaf0.078947
depth 0-20cm0.078947
wheat0.078947
intestine0.070175
water0.061404
mucus0.052632
digestive system0.052632
fresh water0.052632
cultivated environment0.052632
LOWER IN soil0.052632
north china plain0.052632
agricultural feature0.052632
winter0.052632
larval stage0.043860
mexico0.043860
state of rhode island0.043860
foodon product type0.043860
river0.043860
state of tennessee0.043860
marine sediment0.035088
brackish water0.035088
sediment0.035088
caspian sea0.035088
child0.035088
commonwealth of virginia0.035088
solanum lycopersicum0.035088
tomato0.035088
state of california0.035088
food (fermented)0.035088
united kingdom0.035088
adult0.035088
pond0.035088
duodenum0.035088
populus0.035088
tree0.035088
tick0.026316
ixodes scapularis0.026316
body proper0.026316
trachea0.026316
tracheal aspirate0.026316
respiratory technology dependent0.026316
LOWER IN control0.026316
state of alabama0.026316
channel catfish0.026316
ictalurus punctatus0.026316
control0.026316
sus scrofa0.026316
pig0.026316
frog0.026316
feces0.026316
LOWER IN feces0.026316
austria0.026316
greenhouse0.026316
plant0.026316
fish0.026316
desert0.026316
depth 0.5m0.026316
jiulong river0.026316
fujian province0.026316
summer0.026316
LOWER IN winter0.026316
glycine max0.026316
soybean0.026316
triticum aestivum0.026316
LOWER IN root0.026316
depth 150-600m0.017544
sample depth 0-12cm0.017544
depth 200m0.017544
sample depth 12-35cm0.017544
notophthalmus viridescens0.017544
newt0.017544
mucosa0.017544
botanical fruit food product0.017544
wheat bran0.017544
dentition0.017544
pulpitis0.017544
mouth0.017544
grape0.017544
vitis vinifera0.017544
stem0.017544
endosphere0.017544
red pepper sauce0.017544
capsicum annuum0.017544
sichuan province0.017544
bronchial epithelium0.017544
israel0.017544
liolaemus ruibali0.017544
argentina0.017544
small intestine0.017544
stomach0.017544
pair of nares0.017544
australia0.017544
Exp. ID User ID Description Date Region Flag Sequences
141amnonhighfreq marine sediment, brackish water, sediment, caspian sea, depth 150-600m, sample depth 0-12cm2017-04-18v4No1 / 5
262amnonhighfreq tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 8
141amnonhighfreq marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 11
468amnonlower in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in lower respiratory tract disease compared to control in homo sapiens united states of america child trachea tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 13
99amnonhighfreq commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (highfreq homo sapiens, mucosa, sinusoidal space, paranasal sinus, united states of america, sinusitis)2017-10-31v4No1 / 15
481amnonhighfreq united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 17
146amnonhighfreq united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 19
165amnonhigh freq. in moist wheat bran (highfreq research facility, wheat bran, china)2017-07-16v4No1 / 19
105amnonhighfreq brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 20
262amnonlower in tick larvae fed on PIXR immunized mice compared to non immunized ( high in control compared to pixr immunized in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (highfreq homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 50
56amnoncommon nicotiana galuca, flower, nectar, israel2017-01-30v4No1 / 57
374amnoncommon skin, costa rica, amphibia, oophaga pumilio, strawberry poison frog, frog2018-09-09v4No1 / 61
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in day 0 early timepoints compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 74
361amnoncommon leaf, austria, greenhouse, plant, musa paradisiaca2018-08-21v4No1 / 77
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v4No1 / 110
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
232amnoncoomon in foot of healthy controls (common homo sapiens, skin, australia, foot)2017-11-05v4No1 / 166
534amnoncommon river, water, fresh water, depth 10 cm, koshi river, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 172
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 243
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
311amnoncommon in floor of kimchi production facility (common united states of america, state of rhode island, floor, food processing factory)2018-04-09v4No1 / 324
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
433amnoncommon sea water, ocean, depth 4m, indian ocean2018-12-19v4No1 / 333
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
259amnonlower in manured soil compared to non-manured ( high in non-manured soil compared to manured soil in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 397
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 438
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 571
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
454amnon high in summer compared to winter in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 791
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
271amnoncommon rhizosphere, glycine max, depth 0-20cm, soybean, china2018-01-09v4No1 / 1459
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 150-600m, sample depth 0-12cm2017-04-18v4No1 / 1549
141amnoncommon marine sediment, brackish water, sediment, caspian sea, depth 200m, sample depth 12-35cm2017-04-18v4No1 / 1659
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>4, ph<5, china2018-02-11v4No1 / 1886
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>8, china2018-02-11v4No1 / 2646
271amnoncommon depth 0-20cm, soil, china2018-01-09v4No1 / 2856
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
296amnoncommon soil, north china plain, agricultural feature, wheat, winter, depth 0-20cm, ph>5, ph<6, china2018-02-11v4No1 / 3508
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil rhizosphere compared to root structure root in depth 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org