Search result for sequence:
TACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTTATTTAAGTCCGTTGTGAAAGCCCTGGGCTCAACCTGGGAACTGCAGTGGATACTGGATGACTAGAATGTGGTAGAGGGTAGCGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
rainbow trout0.226087
oncorhynchus mykiss0.226087
sweden0.206388
costa rica0.172549
fish0.149856
digestive system0.147368
butterfly0.141593
skin0.139860
whole body0.127273
air0.122093
canada0.103627
greenhouse0.103627
poland0.101010
fishmeal diet0.096154
beetle0.096154
endosphere0.084211
campinas0.082474
saccharum0.079208
sugarcane0.079208
brazil0.079051
state of california0.073260
leaf0.069164
united states of america0.064655
gut content0.063158
beach0.063158
aerosol0.063158
cold environment0.063158
herbivorous beetle0.063158
bon portage island0.063158
oceanodroma leucorhoa0.063158
seabird0.063158
food product type0.063158
amphibia0.063158
intestine0.062016
homo sapiens0.061512
research facility0.061420
stem0.060302
plant0.059406
chicken0.059406
gallus gallus0.059406
china0.058972
commonwealth of virginia0.057692
water0.057554
mucus0.056075
larval stage0.055300
farm0.055172
bird0.053097
australia0.052402
israel0.046875
saliva0.045283
warm temperature habitat0.043011
18c0.043011
gastrointestinal system mucosa0.043011
santa cruz province0.043011
12c0.043011
notophthalmus viridescens0.043011
pyrenees0.043011
nida basin0.043011
fire salamander0.043011
producer c20.043011
alfalfa sprouts0.043011
medicago sativa0.043011
exosphere0.043011
pomacea canaliculata0.043011
golden apple snail0.043011
nanheng river0.043011
qingpu district0.043011
hong kong0.043011
carnivorous beetle0.043011
lowland pasture0.043011
lowland farm0.043011
cow milk (raw)0.043011
cow milk (fluid)0.043011
milk0.043011
weaned0.043011
age 4-7 weeks0.043011
corn and soybean diet0.043011
pacific ocean0.042857
newt0.042105
grape0.042105
vitis vinifera0.042105
salamandra salamandra0.042105
amphibian larval stage0.042105
stream0.042105
jiangxi province0.042105
bolivia0.041237
broiler chicken0.041237
zebra fish0.040404
danio rerio0.039604
LOWER IN soil0.039604
stomach0.038835
frog0.038835
body proper0.038095
LOWER IN feces0.038095
pig0.037383
sus scrofa0.037383
infant0.037037
italy0.036036
river0.035398
kingdom of spain0.034783
Fraction of dbbact annotations with this term covered by the query
TermScore
endosphere0.666667
canada0.666667
greenhouse0.666667
mechanitis polymnia0.500000
orange-spotted tiger clearwing butterfly0.500000
eurema albula0.500000
ghost yellow butterfly0.500000
rainbow trout0.500000
oncorhynchus mykiss0.500000
warm temperature habitat0.500000
18c0.500000
gastrointestinal system mucosa0.500000
wombat tick0.500000
bothriocroton auruginans0.500000
gut content0.500000
phoebis argante0.500000
apricot sulphur butterfly0.500000
beach0.500000
aerosol0.500000
santa cruz province0.500000
anartia fatima0.500000
banded peacock butterfly0.500000
12c0.500000
cold environment0.500000
chlosyne gaudialis0.500000
notophthalmus viridescens0.500000
ixodes antechini0.500000
heliconius sara0.500000
sara longwing butterfly0.500000
reagent0.500000
LOWER IN defatted larvae insect diet0.500000
arawacus togarna0.500000
LOWER IN larvae insect diet0.500000
LOWER IN pre pupae insect diet0.500000
southern united states0.500000
diadophis punctatus0.500000
ringneck snake0.500000
fossorial snake0.500000
xylella fastidiosa temecula10.500000
pierce disease0.500000
age < 3 months0.500000
LOWER IN days 57-600.500000
days 0-30.500000
harvard forest0.500000
plant fluid0.500000
pitcher fluid0.500000
pitcher plant0.500000
sarracenia purpurea0.500000
pyrenees0.500000
uganda0.500000
LOWER IN ceftriaxone0.500000
no ceftriaxone0.500000
pneumonia0.500000
poland0.500000
aphthona venustula0.500000
nida basin0.500000
herbivorous beetle0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
defatted larvae insects diet0.500000
larvae insect diet0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
brood patch0.500000
fire salamander0.500000
bermuda0.500000
porites astreoides0.500000
nectar feeding0.500000
LOWER IN fruit feeding0.500000
food product type0.500000
vigna radiata0.500000
mung bean sprouts0.500000
producer c20.500000
age <1 year0.500000
beaucarnea recurvata0.500000
centricnemus leucogrammus0.500000
mucosa of stomach0.500000
sciurus carolinensis0.500000
eastern gray squirrel0.500000
alfalfa sprouts0.500000
medicago sativa0.500000
producer c10.500000
amphibia0.500000
rhaebo haematiticus0.500000
truando toad0.500000
campinas0.500000
pre-pupae insect diet0.500000
stem surface0.500000
upper stem0.500000
exosphere0.500000
craugastor fitzingeri0.500000
common rain frog0.500000
pomacea canaliculata0.500000
golden apple snail0.500000
nanheng river0.500000
qingpu district0.500000
buccal mass0.500000
hong kong0.500000
Fraction of annotations for the query sequences containing the term
TermScore
digestive system0.235955
research facility0.179775
united states of america0.168539
sweden0.157303
fish0.146067
rainbow trout0.146067
oncorhynchus mykiss0.146067
costa rica0.123596
skin0.112360
homo sapiens0.101124
butterfly0.089888
whole body0.078652
air0.078652
china0.078652
feces0.067416
fishmeal diet0.056180
state of california0.056180
poland0.056180
beetle0.056180
canada0.056180
greenhouse0.056180
brazil0.056180
water0.044944
endosphere0.044944
intestine0.044944
leaf0.044944
saccharum0.044944
sugarcane0.044944
campinas0.044944
farm0.044944
australia0.033708
gut content0.033708
beach0.033708
pacific ocean0.033708
aerosol0.033708
cold environment0.033708
commonwealth of virginia0.033708
mucus0.033708
stem0.033708
adult0.033708
larval stage0.033708
saliva0.033708
plant0.033708
herbivorous beetle0.033708
bon portage island0.033708
bird0.033708
oceanodroma leucorhoa0.033708
seabird0.033708
israel0.033708
food product type0.033708
amphibia0.033708
chicken0.033708
gallus gallus0.033708
warm temperature habitat0.022472
18c0.022472
gastrointestinal system mucosa0.022472
body proper0.022472
santa cruz province0.022472
12c0.022472
contamination0.022472
notophthalmus viridescens0.022472
newt0.022472
grape0.022472
vitis vinifera0.022472
LOWER IN control0.022472
infant0.022472
danio rerio0.022472
zebra fish0.022472
kingdom of spain0.022472
pyrenees0.022472
winter0.022472
bolivia0.022472
nida basin0.022472
salamandra salamandra0.022472
fire salamander0.022472
germany0.022472
amphibian larval stage0.022472
stream0.022472
sea water0.022472
producer c20.022472
stomach0.022472
alfalfa sprouts0.022472
medicago sativa0.022472
exosphere0.022472
frog0.022472
pomacea canaliculata0.022472
golden apple snail0.022472
nanheng river0.022472
qingpu district0.022472
hong kong0.022472
city0.022472
carnivorous beetle0.022472
river0.022472
lowland pasture0.022472
lowland farm0.022472
italy0.022472
cow milk (raw)0.022472
cow milk (fluid)0.022472
milk0.022472
broiler chicken0.022472
Exp. ID User ID Description Date Region Flag Sequences
501amnoncommon costa rica, butterfly, digestive system, mechanitis polymnia, orange-spotted tiger clearwing butterfly2019-03-08v4No1 / 6
501amnoncommon costa rica, butterfly, digestive system, eurema albula, ghost yellow butterfly2019-03-09v4No1 / 6
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 8
621amnondominant wombat tick, bothriocroton auruginans, body proper, whole body, australia2020-05-07v1No1 / 8
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
392amnondominant fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 9
501amnoncommon costa rica, butterfly, digestive system, phoebis argante, apricot sulphur butterfly2019-03-09v4No1 / 9
304amnondominant united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 10
501amnoncommon costa rica, butterfly, digestive system, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 10
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
501amnoncommon costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v4No1 / 13
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
99amnondominant commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 15
621amnondominant tick, ixodes antechini, body proper, whole body, australia2020-05-07v1No1 / 16
501amnoncommon costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 17
588amnonreagent contaminant (contamination)2020-02-10v3No1 / 19
392amnon high in fishmeal diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 21
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 21
392amnon high in fishmeal diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 23
392amnon high in fishmeal diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 24
536amnoncommon snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
614amnondecreases in picher plant fluid grown in lab ( high in wild early time points days 0-3 compared to research facility late time points days 57-60 in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 42
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 42
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, defatted larvae insects diet2018-11-05v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 61
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 64
587amnoncommon israel, food product type, vigna radiata, mung bean sprouts, producer c22020-02-10v3No1 / 67
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 74
596amnon high in age <1 year compared to age 1-7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 78
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v3No1 / 85
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c12020-02-10v3No1 / 106
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
615amnoncommon leaf endosphere, leaf, endosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 122
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
615amnoncommon stem surface, upper stem, stem, exosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 129
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 136
615amnoncommon exosphere, leaf surface, leaf, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 143
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
565amnoncommon skin, canada, zoological garden, captive, toronto zoo, pongo abelii, sumatran orangutan2019-11-21v3No1 / 174
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
604amnoncommon chicken, gallus gallus, cecal content, caecum, china, research facility2020-04-06v3No1 / 185
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 194
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
587amnoncommon israel, food product type, alfalfa sprouts, medicago sativa, producer c22020-02-10v3No1 / 215
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
568amnoncommon gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 272
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
568amnoncommon gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 320
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
617amnonlower in cow milk of cows in alpine pasture compared to lowland farm ( high in lowland farm lowland pasture compared to alpine pasture alpine in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 484
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
615amnon high in endosphere root compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 529
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
323amnonlower in sharks compared to sea water ( high in water surface water depth 0m sea water compared to shark in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 979
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637

Problems / suggestions? Please email info AT dbbact DOT org