Search result for sequence:
TACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTTATTTAAGTCCGTTGTGAAAGCCCTGGGCTCAACCTGGGAACTGCAGTGGATACTGGATGACTAGAATGTGGTAGAGGGTAGCGGAATTCCTGG
common ontology terms
term enrichment score
TermScore
rainbow trout0.268041
oncorhynchus mykiss0.268041
costa rica0.211538
sweden0.200772
fish0.182456
butterfly0.168421
skin0.165289
digestive system0.161538
air0.144828
canada0.131579
fishmeal diet0.116279
poland0.116279
beetle0.116279
whole body0.109890
state of california0.084388
gut content0.077922
beach0.077922
aerosol0.077922
cold environment0.077922
herbivorous beetle0.077922
bon portage island0.077922
oceanodroma leucorhoa0.077922
seabird0.077922
amphibia0.077922
intestine0.076190
plant0.072289
commonwealth of virginia0.069767
mucus0.067416
larval stage0.066298
bird0.065217
united states of america0.062921
homo sapiens0.061102
research facility0.053957
warm temperature habitat0.053333
18c0.053333
gastrointestinal system mucosa0.053333
santa cruz province0.053333
12c0.053333
notophthalmus viridescens0.053333
endosphere0.053333
pyrenees0.053333
nida basin0.053333
fire salamander0.053333
hong kong0.053333
carnivorous beetle0.053333
weaned0.053333
age 4-7 weeks0.053333
corn and soybean diet0.053333
newt0.051948
grape0.051948
vitis vinifera0.051948
salamandra salamandra0.051948
amphibian larval stage0.051948
stream0.051948
jiangxi province0.051948
water0.050847
bolivia0.050633
broiler chicken0.050633
zebra fish0.049383
pacific ocean0.049180
LOWER IN soil0.048780
stem0.048193
danio rerio0.048193
chicken0.048193
gallus gallus0.048193
frog0.047059
LOWER IN feces0.046512
infant0.044944
pig0.044944
sus scrofa0.044944
leaf0.044444
kingdom of spain0.043011
germany0.043011
river0.042105
sea water0.040000
winter0.039604
adult0.038710
city0.038095
farm0.034188
saliva0.033058
feces0.031209
china0.028916
mechanitis polymnia0.027397
orange-spotted tiger clearwing butterfly0.027397
eurema albula0.027397
ghost yellow butterfly0.027397
phoebis argante0.027397
apricot sulphur butterfly0.027397
anartia fatima0.027397
banded peacock butterfly0.027397
chlosyne gaudialis0.027397
heliconius sara0.027397
sara longwing butterfly0.027397
LOWER IN defatted larvae insect diet0.027397
arawacus togarna0.027397
LOWER IN larvae insect diet0.027397
LOWER IN pre pupae insect diet0.027397
southern united states0.027397
diadophis punctatus0.027397
ringneck snake0.027397
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
mechanitis polymnia0.500000
orange-spotted tiger clearwing butterfly0.500000
eurema albula0.500000
ghost yellow butterfly0.500000
rainbow trout0.500000
oncorhynchus mykiss0.500000
warm temperature habitat0.500000
18c0.500000
gastrointestinal system mucosa0.500000
gut content0.500000
phoebis argante0.500000
apricot sulphur butterfly0.500000
beach0.500000
aerosol0.500000
santa cruz province0.500000
anartia fatima0.500000
banded peacock butterfly0.500000
12c0.500000
cold environment0.500000
chlosyne gaudialis0.500000
notophthalmus viridescens0.500000
heliconius sara0.500000
sara longwing butterfly0.500000
LOWER IN defatted larvae insect diet0.500000
arawacus togarna0.500000
LOWER IN larvae insect diet0.500000
LOWER IN pre pupae insect diet0.500000
southern united states0.500000
diadophis punctatus0.500000
ringneck snake0.500000
fossorial snake0.500000
endosphere0.500000
xylella fastidiosa temecula10.500000
pierce disease0.500000
age < 3 months0.500000
pyrenees0.500000
uganda0.500000
LOWER IN ceftriaxone0.500000
no ceftriaxone0.500000
pneumonia0.500000
aphthona venustula0.500000
nida basin0.500000
herbivorous beetle0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
defatted larvae insects diet0.500000
larvae insect diet0.500000
bon portage island0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
brood patch0.500000
fire salamander0.500000
bermuda0.500000
porites astreoides0.500000
nectar feeding0.500000
LOWER IN fruit feeding0.500000
greenhouse0.500000
beaucarnea recurvata0.500000
centricnemus leucogrammus0.500000
mucosa of stomach0.500000
eastern gray squirrel0.500000
sciurus carolinensis0.500000
amphibia0.500000
rhaebo haematiticus0.500000
truando toad0.500000
pre-pupae insect diet0.500000
craugastor fitzingeri0.500000
common rain frog0.500000
hong kong0.500000
subway0.500000
craugastor bransfordii0.500000
bransford’s litter frog0.500000
sumatran orangutan0.500000
pongo abelii0.500000
toronto zoo0.500000
water treatment plant0.500000
LOWER IN distribution system0.500000
bembidion decorum0.500000
carnivorous beetle0.500000
raba river0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
pond0.500000
viet nam0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
LOWER IN burrow0.500000
LOWER IN achatinella mustelina0.500000
new delhi0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
south florida0.500000
LOWER IN shark0.500000
carabidae0.500000
Fraction of annotations for the query sequences containing the term
TermScore
digestive system0.295775
research facility0.211268
united states of america0.197183
sweden0.183099
fish0.183099
rainbow trout0.183099
oncorhynchus mykiss0.183099
costa rica0.154930
skin0.140845
butterfly0.112676
homo sapiens0.112676
air0.098592
feces0.084507
fishmeal diet0.070423
state of california0.070423
poland0.070423
whole body0.070423
beetle0.070423
canada0.070423
intestine0.056338
gut content0.042254
beach0.042254
pacific ocean0.042254
aerosol0.042254
cold environment0.042254
commonwealth of virginia0.042254
mucus0.042254
adult0.042254
larval stage0.042254
plant0.042254
herbivorous beetle0.042254
bon portage island0.042254
bird0.042254
oceanodroma leucorhoa0.042254
seabird0.042254
amphibia0.042254
water0.042254
china0.042254
warm temperature habitat0.028169
18c0.028169
gastrointestinal system mucosa0.028169
santa cruz province0.028169
12c0.028169
notophthalmus viridescens0.028169
newt0.028169
grape0.028169
vitis vinifera0.028169
stem0.028169
endosphere0.028169
LOWER IN control0.028169
infant0.028169
danio rerio0.028169
zebra fish0.028169
kingdom of spain0.028169
pyrenees0.028169
winter0.028169
saliva0.028169
bolivia0.028169
nida basin0.028169
salamandra salamandra0.028169
fire salamander0.028169
germany0.028169
amphibian larval stage0.028169
stream0.028169
sea water0.028169
leaf0.028169
frog0.028169
hong kong0.028169
city0.028169
carnivorous beetle0.028169
river0.028169
broiler chicken0.028169
chicken0.028169
gallus gallus0.028169
pig0.028169
sus scrofa0.028169
farm0.028169
jiangxi province0.028169
weaned0.028169
age 4-7 weeks0.028169
corn and soybean diet0.028169
LOWER IN soil0.028169
LOWER IN feces0.028169
mechanitis polymnia0.014085
orange-spotted tiger clearwing butterfly0.014085
eurema albula0.014085
ghost yellow butterfly0.014085
phoebis argante0.014085
apricot sulphur butterfly0.014085
anartia fatima0.014085
banded peacock butterfly0.014085
chlosyne gaudialis0.014085
contamination0.014085
heliconius sara0.014085
sara longwing butterfly0.014085
LOWER IN defatted larvae insect diet0.014085
arawacus togarna0.014085
LOWER IN larvae insect diet0.014085
LOWER IN pre pupae insect diet0.014085
snake0.014085
Exp. ID User ID Description Date Region Flag Sequences
501amnoncommon costa rica, butterfly, digestive system, mechanitis polymnia, orange-spotted tiger clearwing butterfly2019-03-08v4No1 / 6
501amnoncommon costa rica, butterfly, digestive system, eurema albula, ghost yellow butterfly2019-03-09v4No1 / 6
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 8
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
392amnonhighfreq fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 9
501amnoncommon costa rica, butterfly, digestive system, phoebis argante, apricot sulphur butterfly2019-03-09v4No1 / 9
304amnonhighfreq united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 10
501amnoncommon costa rica, butterfly, digestive system, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 10
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
501amnoncommon costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v4No1 / 13
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
99amnonhighfreq commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 15
501amnoncommon costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 17
392amnon high in fishmeal diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 21
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 21
392amnon high in fishmeal diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 23
392amnon high in fishmeal diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 24
536amnoncommon snake, skin, united states of america, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
403amnoncommon air, kingdom of spain, pyrenees, winter2018-11-18v4No1 / 42
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, defatted larvae insects diet2018-11-05v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 61
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 64
574amnoncommon adult, russia, homo sapiens, feces2020-01-05v3No1 / 68
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 74
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
569amnoncommon in gastric biopsies of patients negative for h. pylori (common biopsy, stomach, mucosa of stomach, south korea, homo sapiens)2019-12-16v3No1 / 85
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
565amnoncommon eastern gray squirrel, sciurus carolinensis, canada, skin2019-11-21v3No1 / 104
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
374amnoncommon skin, costa rica, amphibia, rhaebo haematiticus, truando toad, toad2018-09-09v4No1 / 121
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
374amnoncommon skin, costa rica, amphibia, craugastor fitzingeri, common rain frog, frog2018-09-09v4No1 / 136
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
374amnoncommon skin, costa rica, amphibia, craugastor bransfordii, bransford’s litter frog, frog2018-09-09v4No1 / 171
565amnoncommon sumatran orangutan, pongo abelii, toronto zoo, captive, zoological garden, canada, skin2019-11-21v3No1 / 174
403amnon high in winter compared to summer in air kingdom of spain pyrenees autumn 2018-11-18v4No1 / 176
109amnon high in water treatment plant compared to distribution system in usa water drinking water site c 2017-04-08v4No1 / 193
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, monterey bay2018-03-12v4No1 / 263
568amnoncommon viet nam, broiler chicken, feces, chicken, gallus gallus2019-12-08v3No1 / 272
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
568amnoncommon thailand, broiler chicken, feces, chicken, gallus gallus2019-12-08v3No1 / 320
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
271amnon high in rhizosphere glycine max soybean compared to soil in depth 0-20cm china 2018-01-09v4No1 / 750
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
323amnonlower in sharks compared to sea water ( high in water surface water depth 0m sea water compared to shark in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 979
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130

Problems / suggestions? Please email info AT dbbact DOT org