Search result for sequence:
TACGAAGGGTGCAAGCGTTGTTCGGATTTATTGGGCGTAAAGCGCGCGCAGGCGGACCTGTAAGTCAGATGTGAAATCTCGGGGCTCAACTCCGAAACTGCGTCTGAAACTACAGGTCTAGAATCTCGGAGAGGGATGGGGTATTTCACA
common ontology terms
term enrichment score
TermScore
koshi river0.571429
tributary0.571429
nepal0.444444
LOWER IN amerindian0.400000
LOWER IN hunter gatherer0.400000
LOWER IN venezuela0.400000
depth 10 cm0.363636
filtered 0.2um0.333333
particle bound0.333333
filtered 2.7um0.333333
free floating0.250000
river0.148148
fresh water0.097561
city0.095238
skin0.066667
water0.038835
homo sapiens0.010870
united states of america0.009852
Fraction of dbbact annotations with this term covered by the query
TermScore
koshi river0.500000
tributary0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
nepal0.333333
filtered 0.2um0.333333
particle bound0.333333
filtered 2.7um0.333333
depth 10 cm0.250000
free floating0.200000
river0.083333
city0.055556
fresh water0.052632
skin0.037037
water0.020000
homo sapiens0.005525
united states of america0.005000
Fraction of annotations for the query sequences containing the term
TermScore
river0.666667
water0.666667
fresh water0.666667
depth 10 cm0.666667
koshi river0.666667
tributary0.666667
nepal0.666667
free floating0.333333
filtered 0.2um0.333333
particle bound0.333333
filtered 2.7um0.333333
homo sapiens0.333333
skin0.333333
united states of america0.333333
city0.333333
LOWER IN amerindian0.333333
LOWER IN hunter gatherer0.333333
LOWER IN venezuela0.333333

Problems / suggestions? Please email info AT dbbact DOT org