Search result for sequence:
TACGAAGGGTGCAAGCGTTGTTCGGATTTATTGGGCGTAAAGCGCGCGCAGGCGGACCTGTAAGTCAGATGTGAAATCTCGGGGCTCAACTCCGAAACTGCGTCTGAAACTACAGGTCTAGAATCTCGGAGAGGGATGGGGTATTTCACA
common ontology terms
term enrichment score
TermScore
koshi river0.571429
tributary0.571429
nepal0.444444
LOWER IN amerindian0.400000
LOWER IN hunter gatherer0.400000
LOWER IN venezuela0.400000
depth 10 cm0.363636
filtered 0.2um0.285714
particle bound0.285714
filtered 2.7um0.285714
free floating0.222222
river0.148148
fresh water0.093023
city0.090909
skin0.060606
water0.035398
united states of america0.008772
homo sapiens0.008511
Fraction of dbbact annotations with this term covered by the query
TermScore
koshi river0.500000
tributary0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
nepal0.333333
depth 10 cm0.250000
filtered 0.2um0.250000
particle bound0.250000
filtered 2.7um0.250000
free floating0.166667
river0.083333
city0.052632
fresh water0.050000
skin0.033333
water0.018182
united states of america0.004444
homo sapiens0.004310
Fraction of annotations for the query sequences containing the term
TermScore
river0.666667
water0.666667
fresh water0.666667
depth 10 cm0.666667
koshi river0.666667
tributary0.666667
nepal0.666667
free floating0.333333
filtered 0.2um0.333333
particle bound0.333333
filtered 2.7um0.333333
homo sapiens0.333333
skin0.333333
united states of america0.333333
city0.333333
LOWER IN amerindian0.333333
LOWER IN hunter gatherer0.333333
LOWER IN venezuela0.333333

Problems / suggestions? Please email info AT dbbact DOT org