Search result for sequence:
TACGAGAGGCCCTAGTTGATAACTACCGGCGTAAAGAGTGGTTATGGAAAAATATTTAATAAAGCCGAACACCCCCTCAGCCGTCATACGCACCTGGGAGCACGAAGACCTACTGCGAAAGCAGCTTTAACTATGCCTGACCCCACGACA
common ontology terms
term enrichment score
TermScore
rainbow trout0.666667
oncorhynchus mykiss0.666667
18c0.500000
gut content0.428571
warm temperature habitat0.428571
gastrointestinal system mucosa0.428571
sweden0.333333
LOWER IN 12c0.333333
LOWER IN cold environment0.333333
12c0.333333
cold environment0.333333
fishmeal diet0.285714
fish0.266667
warm termpterature habitat0.200000
LOWER IN pre pupae insect diet0.200000
digestive system0.133333
research facility0.036364
Fraction of dbbact annotations with this term covered by the query
TermScore
rainbow trout0.500000
oncorhynchus mykiss0.500000
gut content0.500000
warm temperature habitat0.500000
18c0.500000
LOWER IN 12c0.500000
LOWER IN cold environment0.500000
gastrointestinal system mucosa0.500000
warm termpterature habitat0.500000
12c0.500000
cold environment0.500000
LOWER IN pre pupae insect diet0.500000
fishmeal diet0.333333
sweden0.200000
fish0.153846
digestive system0.071429
research facility0.018519
Fraction of annotations for the query sequences containing the term
TermScore
sweden1.000000
fish1.000000
rainbow trout1.000000
oncorhynchus mykiss1.000000
research facility1.000000
digestive system1.000000
18c0.500000
gut content0.375000
warm temperature habitat0.375000
gastrointestinal system mucosa0.375000
LOWER IN 12c0.250000
LOWER IN cold environment0.250000
12c0.250000
cold environment0.250000
fishmeal diet0.250000
warm termpterature habitat0.125000
LOWER IN pre pupae insect diet0.125000
Exp. ID User ID Description Date Region Flag Sequences
313amnonlower in gut content of fish grown in 12C compared to 18C water ( high in warm temperature habitat 18c compared to 12c cold environment in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 3
313amnonlower in gut mucosa of fish grown in 12C compared to 18C water ( high in warm termpterature habitat 18c compared to 12c cold environment in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 3
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 8
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
392amnon high in fishmeal diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 24
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34

Problems / suggestions? Please email info AT dbbact DOT org