dbBact sequence annotation

×

Search result for sequence:

TACGAGGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGTGCGGTAAGTCACCTGTGAAACCTCCGGGCTCAACCCGGAGCCTGCAGGCGATACTGCCGTGCTAGAGGATGGGAGAGGTGCGTGGAATTCCCGG

Taxonomy: dBacteria;p"Acidobacteria";c__Acidobacteria_Gp1;g__Gp1

species	# matches	SILVA IDs

common ontology terms

term enrichment score

Term	Score
mature soil	0.500000
minas gerais state	0.500000
campos rupestres	0.500000
barbacenia macrantha	0.500000
nenets autonomous okrug	0.400000
permafrost	0.333333
root endosphere	0.333333
tundra	0.285714
LOWER IN sand	0.222222
russia	0.153846
root	0.117647
brazil	0.095238
soil	0.019417

Fraction of dbbact annotations with this term covered by the query

Term	Score
mature soil	0.500000
minas gerais state	0.500000
campos rupestres	0.500000
barbacenia macrantha	0.500000
nenets autonomous okrug	0.333333
permafrost	0.250000
root endosphere	0.250000
tundra	0.200000
LOWER IN sand	0.142857
russia	0.090909
root	0.066667
brazil	0.052632
soil	0.009901

Fraction of annotations for the query sequences containing the term

Term	Score
soil	0.500000
tundra	0.500000
permafrost	0.500000
russia	0.500000
nenets autonomous okrug	0.500000
mature soil	0.500000
LOWER IN sand	0.500000
minas gerais state	0.500000
campos rupestres	0.500000
brazil	0.500000
barbacenia macrantha	0.500000
root endosphere	0.500000
root	0.500000

Exp. ID	User ID	Description	Date	Region	Flag	Sequences
426	amnon	high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug	2018-12-08	v4	No	1 / 377
548	amnon	common minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root	2019-08-17	v4	No	1 / 575

Problems / suggestions? Please email info AT dbbact DOT org