Search result for sequence:
TACGAGGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGTGCGGTAAGTCACCTGTGAAACCTCTAGGCTTAACCTAGAGCCTGCAGGCGAAACTGCCGTGCTTGAGGGTGGGAGAGGTGCGTGGAATTCCCGG
common ontology terms
term enrichment score
TermScore
soil0.300792
kellogg biological station0.285714
mesic type hapludalf0.285714
kalamazoo loam0.285714
restored prairie0.210526
cultivated environment0.177966
miscanthus0.166667
rhizosphere0.157303
mesocosm0.142857
depth 50-100m0.142857
panicum virgatum0.142857
topsoil0.140351
state of idaho0.133333
ph 60.133333
state of michigan0.133333
corn0.133333
forest ecosystem0.111111
silt loam0.111111
depth (soil) 25-50cm0.111111
depth (soil) 0-10cm0.103448
canada0.100000
root0.100000
tree0.100000
state of tennessee0.100000
state of georgia0.100000
minas gerais state0.090909
campos rupestres0.090909
coarse-loamy soil0.090909
day 820.090909
robinia pseudoacacia0.090909
reforestation0.090909
20 years0.090909
shaanxi province0.090909
citrus0.088889
province of quebec0.086957
depth (soil) 0-5cm0.086957
depth (soil) 10-25cm0.086957
loess plateau0.086957
depth (soil) 0-20cm0.069767
taxus0.062500
taxus mairei0.062500
bon portage island0.062500
burrow0.062500
ph 5.50.062500
subpolar coniferous forest biome0.062500
boreal forest0.062500
depth 30-75cm0.062500
silt clay loam0.062500
populus0.062500
barbacenia macrantha0.062500
continuous corn0.062500
forested area0.061538
state of new york0.060606
paddy field soil0.060606
heilongjiang province0.060606
china0.055115
oryza sativa0.054054
LOWER IN root0.053333
united states of america0.051367
brazil0.051282
woodland area0.048780
depth (soil) 20-60cm0.045455
state of florida0.041667
field soil0.032258
quincy, fl0.032258
ft. pierce, fl0.032258
central park0.032258
southeast china0.032258
LOWER IN taxus media0.032258
LOWER IN taxus cuspidata0.032258
LOWER IN temperate0.032258
temperate0.032258
oceanodroma leucorhoa0.032258
seabird0.032258
surface burrow0.032258
LOWER IN deep burrow0.032258
LOWER IN seabird0.032258
LOWER IN oceanodroma leucorhoa0.032258
LOWER IN soilwater0.032258
soilwater0.032258
boechera stricta0.032258
ph 5.40.032258
ph>30.032258
LOWER IN ph<30.032258
reunion island0.032258
bank vole0.032258
myodes glareolus0.032258
ukraine0.032258
no human contact0.032258
chernobyl exclusion zone0.032258
quesnel lake0.032258
contaminated sediment0.032258
stover ammendment 0.032258
elevation 1300-1400m0.032258
lushan mountain0.032258
LOWER IN cherokia georgiana georgiana0.032258
LOWER IN millipede0.032258
cherokia georgiana georgiana0.032258
millipede0.032258
temperate rainforest0.032258
Fraction of dbbact annotations with this term covered by the query
TermScore
field soil0.500000
quincy, fl0.500000
ft. pierce, fl0.500000
central park0.500000
taxus0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN taxus media0.500000
LOWER IN taxus cuspidata0.500000
LOWER IN temperate0.500000
temperate0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
burrow0.500000
surface burrow0.500000
LOWER IN deep burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
LOWER IN soilwater0.500000
soilwater0.500000
ph 5.50.500000
boechera stricta0.500000
ph 5.40.500000
subpolar coniferous forest biome0.500000
boreal forest0.500000
ph>30.500000
LOWER IN ph<30.500000
reunion island0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
no human contact0.500000
chernobyl exclusion zone0.500000
depth 30-75cm0.500000
silt clay loam0.500000
populus0.500000
quesnel lake0.500000
contaminated sediment0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment 0.500000
elevation 1300-1400m0.500000
lushan mountain0.500000
LOWER IN cherokia georgiana georgiana0.500000
LOWER IN millipede0.500000
mesocosm0.500000
cherokia georgiana georgiana0.500000
millipede0.500000
temperate rainforest0.500000
olympic national park0.500000
kellogg biological station0.500000
mesic type hapludalf0.500000
kalamazoo loam0.500000
continuous corn0.500000
depth 50-100m0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
robinia pseudoacacia0.500000
reforestation0.500000
20 years0.500000
shaanxi province0.500000
LOWER IN 10 years0.500000
LOWER IN 30 years0.500000
topsoil0.444444
citrus0.400000
forested area0.400000
cultivated environment0.375000
nicotiana tabacum0.333333
park0.333333
ph<60.333333
LOWER IN ph&gt;60.333333
LOWER IN northeast china0.333333
subtropical0.333333
northeast china0.333333
province of quebec0.333333
state of idaho0.333333
ph 60.333333
LOWER IN soybean0.333333
soybean0.333333
forest ecosystem0.333333
hokkaido0.333333
paddy field soil0.333333
heilongjiang province0.333333
LOWER IN human contact0.333333
nenets autonomous okrug0.333333
silt loam0.333333
depth (soil) 0-5cm0.333333
coniferous forest biome0.333333
LOWER IN plant litter0.333333
plant litter0.333333
depth (soil) 25-50cm0.333333
corn0.333333
depth (soil) 10-25cm0.333333
LOWER IN depth (soil) 10-25cm0.333333
LOWER IN depth (soil) 25-50cm0.333333
Fraction of annotations for the query sequences containing the term
TermScore
soil0.750000
united states of america0.516667
state of michigan0.200000
kellogg biological station0.200000
mesic type hapludalf0.200000
kalamazoo loam0.200000
china0.183333
rhizosphere0.166667
restored prairie0.133333
cultivated environment0.116667
canada0.100000
miscanthus0.100000
state of idaho0.083333
ph 60.083333
topsoil0.083333
mesocosm0.083333
state of georgia0.083333
corn0.083333
depth 50-100m0.083333
panicum virgatum0.083333
root0.066667
tree0.066667
depth (soil) 0-20cm0.066667
depth (soil) 0-10cm0.066667
forest ecosystem0.066667
state of tennessee0.066667
silt loam0.066667
depth (soil) 25-50cm0.066667
citrus0.050000
province of quebec0.050000
minas gerais state0.050000
campos rupestres0.050000
brazil0.050000
depth (soil) 0-5cm0.050000
state of new york0.050000
coarse-loamy soil0.050000
day 820.050000
depth (soil) 10-25cm0.050000
robinia pseudoacacia0.050000
reforestation0.050000
20 years0.050000
loess plateau0.050000
shaanxi province0.050000
state of florida0.033333
taxus0.033333
taxus mairei0.033333
bon portage island0.033333
burrow0.033333
ph 5.50.033333
LOWER IN root0.033333
subpolar coniferous forest biome0.033333
boreal forest0.033333
woodland area0.033333
paddy field soil0.033333
oryza sativa0.033333
heilongjiang province0.033333
depth (soil) 20-60cm0.033333
depth 30-75cm0.033333
silt clay loam0.033333
populus0.033333
barbacenia macrantha0.033333
forested area0.033333
continuous corn0.033333
field soil0.016667
nicotiana tabacum0.016667
quincy, fl0.016667
ft. pierce, fl0.016667
urban biome0.016667
park0.016667
new york city0.016667
central park0.016667
ph0.016667
ph<60.016667
LOWER IN ph&gt;60.016667
southeast china0.016667
LOWER IN taxus media0.016667
LOWER IN taxus cuspidata0.016667
LOWER IN northeast china0.016667
subtropical0.016667
LOWER IN temperate0.016667
northeast china0.016667
temperate0.016667
bird0.016667
oceanodroma leucorhoa0.016667
seabird0.016667
surface burrow0.016667
LOWER IN deep burrow0.016667
LOWER IN bird0.016667
LOWER IN seabird0.016667
LOWER IN oceanodroma leucorhoa0.016667
LOWER IN soilwater0.016667
LOWER IN water0.016667
soilwater0.016667
water0.016667
brassicaceae0.016667
boechera stricta0.016667
plant0.016667
LOWER IN leaf0.016667
LOWER IN rhizosphere0.016667
LOWER IN glycine max0.016667
Exp. ID User ID Description Date Region Flag Sequences
426amnoncommon soil, tundra, permafrost, russia, nenets autonomous okrug2018-12-08v4No1 / 81
316amnoncommon united states of america, soil, topsoil, state of ohio, depth (soil) 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 199
788amnoncommon plant litter, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 259
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
821sheryoHigher at 50-100cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth 50-100m compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 543
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
788amnoncommon cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 607
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
357amnon high in ph>3 compared to ph<3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common depth 50-100m, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 726
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, soil, depth 30-75cm, silt clay loam, cultivated environment2019-01-13v4No1 / 728
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common depth 50-100m, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 744
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
821sheryoHigher at 25-50cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 812
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
265amnoncommon canada, province of quebec, soilwater, water2017-12-11v4No1 / 841
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common depth 50-100m, panicum virgatum, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 872
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 901
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
821sheryoHigher at 10-25cm depth compared to 0-10cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 0-10cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 930
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, soil, silt loam, cultivated environment2019-01-13v4No1 / 938
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 968
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1247
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-02v4No1 / 1387
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3893
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org