Search result for sequence:
TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCTTTTAAGTCAGCGGTCAAATGTCACGGCTCAACCGTGGCCAGCCGTTGAAACTGCAAGCCTTGAGTCTGCACAGGGCACATGGAATTCGTGGT
common ontology terms
term enrichment score
TermScore
china0.237624
homo sapiens0.155162
feces0.135508
adult0.132177
denver0.114286
nanning city prefecture0.114286
sixth decade human stage0.114286
low anterior resection0.114286
taipei city0.114286
wistar rat0.108108
rattus0.106195
rat0.103448
obese body mass index status0.102564
taiwan0.102564
kingdom of denmark0.102564
hiv infection0.097561
heterosexual0.097561
msw0.097561
LOWER IN crohn's disease0.093023
obesity0.088889
poland0.085714
czech republic0.085106
state of colorado0.081633
city0.078431
united states of america0.072679
infant0.070175
atherosclerosis0.062500
lima0.062500
male0.062500
insomnia0.060606
LOWER IN nephrolithiasis0.060606
caribbean latino0.060606
non usa born0.060606
LOWER IN usa born0.060606
gangcha region0.060606
LOWER IN gannan tibetan autonomous prefecture0.060606
shantytown0.060606
LOWER IN el salado0.060606
children0.060606
LOWER IN age 3-60.060606
LOWER IN age 8-120.060606
LOWER IN dnbs induced colitis0.060606
caecum0.059701
tibet autonomous region0.058824
estonia0.058824
age < 3 years0.058824
metabolic syndrome0.058824
LOWER IN venezuela0.058824
LOWER IN amerindian0.058824
colon0.058824
65-79 year-old human stage0.058824
LOWER IN gay0.057143
hispanic or latin american0.057143
LOWER IN small village0.057143
LOWER IN vancomycin0.057143
LOWER IN neomycin0.057143
LOWER IN hunter gatherer0.057143
sigmoid colon0.057143
terminal ileum0.057143
fifth decade human stage0.057143
gay0.057143
control0.056718
LOWER IN 6-12 year-old child stage0.055556
LOWER IN heterosexual0.055556
LOWER IN msw0.055556
LOWER IN homosexual0.054054
LOWER IN msm0.054054
tibetan plateau0.054054
homosexual0.054054
msm0.054054
LOWER IN 1-month-old human stage0.054054
bronchoalveolar lavage0.052632
LOWER IN metronidazole0.052632
india0.052632
fourth decade human stage0.052632
belgium0.051282
biopsy0.051282
LOWER IN low bmi0.050000
switzerland0.050000
commonwealth of massachusetts0.050000
lung0.048780
human late adulthood stage0.048780
LOWER IN russia0.048780
sprague dawley0.048780
rectum0.047619
LOWER IN 2-5 year-old child stage0.047619
crohn's disease0.046512
high bmi0.045455
sweden0.043478
1-year-old human stage0.043478
LOWER IN colitis0.043478
LOWER IN antibiotic0.042553
LOWER IN under-1-year-old human stage0.040000
kingdom of spain0.038462
age0.038462
LOWER IN control0.037037
canada0.035714
state of california0.035088
LOWER IN infant0.035088
LOWER IN child0.029851
Fraction of dbbact annotations with this term covered by the query
TermScore
china1.500000
atherosclerosis1.000000
lima1.000000
insomnia0.500000
denver0.500000
LOWER IN nephrolithiasis0.500000
nanning city prefecture0.500000
sixth decade human stage0.500000
caribbean latino0.500000
non usa born0.500000
LOWER IN usa born0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
low anterior resection0.500000
taipei city0.500000
shantytown0.500000
LOWER IN el salado0.500000
children0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN dnbs induced colitis0.500000
tibet autonomous region0.333333
estonia0.333333
age < 3 years0.333333
wistar rat0.333333
metabolic syndrome0.333333
LOWER IN venezuela0.333333
LOWER IN amerindian0.333333
colon0.333333
65-79 year-old human stage0.333333
obese body mass index status0.250000
LOWER IN gay0.250000
hispanic or latin american0.250000
taiwan0.250000
LOWER IN small village0.250000
LOWER IN vancomycin0.250000
LOWER IN neomycin0.250000
kingdom of denmark0.250000
LOWER IN hunter gatherer0.250000
sigmoid colon0.250000
terminal ileum0.250000
fifth decade human stage0.250000
gay0.250000
hiv infection0.200000
heterosexual0.200000
msw0.200000
LOWER IN 6-12 year-old child stage0.200000
LOWER IN heterosexual0.200000
LOWER IN msw0.200000
LOWER IN homosexual0.166667
LOWER IN msm0.166667
tibetan plateau0.166667
LOWER IN crohn&#39;s disease0.166667
homosexual0.166667
msm0.166667
LOWER IN 1-month-old human stage0.166667
obesity0.142857
bronchoalveolar lavage0.142857
LOWER IN metronidazole0.142857
india0.142857
fourth decade human stage0.142857
belgium0.125000
czech republic0.125000
biopsy0.125000
rattus0.117647
LOWER IN low bmi0.111111
switzerland0.111111
state of colorado0.111111
commonwealth of massachusetts0.111111
rat0.111111
lung0.100000
human late adulthood stage0.100000
LOWER IN russia0.100000
city0.100000
sprague dawley0.100000
rectum0.090909
LOWER IN 2-5 year-old child stage0.090909
homo sapiens0.084871
crohn's disease0.083333
high bmi0.076923
poland0.076923
infant0.076923
adult0.075145
feces0.073248
sweden0.066667
1-year-old human stage0.066667
LOWER IN colitis0.066667
LOWER IN antibiotic0.062500
male0.060606
caecum0.055556
LOWER IN under-1-year-old human stage0.052632
kingdom of spain0.047619
age0.047619
united states of america0.040486
canada0.040000
state of california0.038462
LOWER IN infant0.038462
control0.032432
LOWER IN child0.027778
LOWER IN control0.021622
Fraction of annotations for the query sequences containing the term
TermScore
feces0.903226
homo sapiens0.903226
adult0.548387
united states of america0.354839
control0.225806
LOWER IN control0.129032
china0.129032
poland0.096774
research facility0.096774
rattus0.096774
rat0.096774
hiv infection0.064516
obesity0.064516
obese body mass index status0.064516
state of colorado0.064516
denver0.064516
heterosexual0.064516
msw0.064516
nanning city prefecture0.064516
sixth decade human stage0.064516
low anterior resection0.064516
taipei city0.064516
taiwan0.064516
infant0.064516
city0.064516
male0.064516
czech republic0.064516
wistar rat0.064516
kingdom of denmark0.064516
LOWER IN crohn&#39;s disease0.064516
caecum0.064516
insomnia0.032258
high bmi0.032258
LOWER IN low bmi0.032258
switzerland0.032258
crohn's disease0.032258
belgium0.032258
LOWER IN nephrolithiasis0.032258
lung0.032258
bronchoalveolar lavage0.032258
commonwealth of massachusetts0.032258
caribbean latino0.032258
human late adulthood stage0.032258
LOWER IN gay0.032258
LOWER IN homosexual0.032258
LOWER IN msm0.032258
non usa born0.032258
LOWER IN usa born0.032258
hispanic or latin american0.032258
gangcha region0.032258
LOWER IN gannan tibetan autonomous prefecture0.032258
tibetan plateau0.032258
tibet autonomous region0.032258
estonia0.032258
LOWER IN russia0.032258
age < 3 years0.032258
canada0.032258
atherosclerosis0.032258
lima0.032258
shantytown0.032258
LOWER IN el salado0.032258
LOWER IN small village0.032258
LOWER IN female0.032258
LOWER IN antibiotic0.032258
LOWER IN vancomycin0.032258
LOWER IN metronidazole0.032258
LOWER IN neomycin0.032258
state of california0.032258
metabolic syndrome0.032258
sprague dawley0.032258
LOWER IN venezuela0.032258
LOWER IN amerindian0.032258
LOWER IN hunter gatherer0.032258
LOWER IN infant0.032258
LOWER IN under-1-year-old human stage0.032258
india0.032258
rectum0.032258
colon0.032258
sigmoid colon0.032258
terminal ileum0.032258
biopsy0.032258
children0.032258
65-79 year-old human stage0.032258
fourth decade human stage0.032258
fifth decade human stage0.032258
LOWER IN child0.032258
LOWER IN age 3-60.032258
LOWER IN age 8-120.032258
LOWER IN 2-5 year-old child stage0.032258
LOWER IN 6-12 year-old child stage0.032258
gay0.032258
homosexual0.032258
msm0.032258
LOWER IN heterosexual0.032258
LOWER IN msw0.032258
kingdom of spain0.032258
sweden0.032258
age0.032258
1-year-old human stage0.032258
LOWER IN 1-month-old human stage0.032258
Exp. ID User ID Description Date Region Flag Sequences
566amnon high in insomnia compared to control in feces homo sapiens adult china 2019-11-24v4No1 / 23
51amnon high in hiv infection compared to control in feces homo sapiens united states of america 2017-01-19v4No1 / 39
663amnon high in obesity obese body mass index status high bmi compared to low bmi in feces homo sapiens adult poland switzerland 2020-09-22v4No1 / 44
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 83
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 89
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 107
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 309
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 407
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 519
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 754

Problems / suggestions? Please email info AT dbbact DOT org