Search result for sequence:
TACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGCGGCGTAAGTCAGTTGTGAAATCGTGCGGCTTAACCGTGCAATTGCAGTTGATACTGCGTCGCTTGAGTGCACACAGGGATGTTGGAATTCATGG
common ontology terms
term enrichment score
TermScore
rural community0.359281
homo sapiens0.289620
child0.264317
feces0.231579
hunter gatherer0.176471
LOWER IN united states of america0.172414
adult0.156646
homosexual0.142857
gay0.142857
msm0.142857
india0.142857
chuquisaca department0.137931
age 5-13 years0.137931
state of colorado0.125000
bolivia0.121212
obsolete_juvenile stage0.114286
amerindian0.110092
venezuela0.110092
thailand0.107143
small village0.107143
zoological garden0.104348
city0.097561
LOWER IN heterosexual0.075472
LOWER IN msw0.075472
gorilla gorilla0.075472
himalayas0.074074
denver0.074074
myanmar0.074074
karen0.074074
kebbi state0.074074
age 10-15 years0.074074
hadza0.074074
LOWER IN age 30-500.074074
LOWER IN age 60-790.074074
africa0.074074
mongolian sheep0.074074
tunapuco0.074074
LOWER IN mouth mucosa0.074074
united states of america0.072398
nepal0.071429
egypt0.071429
nigeria0.071429
tanzania0.071429
peru0.071429
LOWER IN city0.071429
rectum0.067797
ovis aries0.064516
LOWER IN mouth0.062500
LOWER IN feces0.061538
infant0.058824
przewalski horse0.038462
raute0.038462
LOWER IN gangcha region0.038462
gannan tibetan autonomous prefecture0.038462
schistosomiasis0.038462
urinary schistosomiasis0.038462
estonia0.038462
LOWER IN russia0.038462
low income0.038462
LOWER IN sewer0.038462
LOWER IN wastewater treatment plant0.038462
age 130.038462
china0.038462
age 19-240.038462
LOWER IN age >940.038462
soldiers0.038462
gorilla0.038462
antananarivo0.038462
madagascar0.038462
LOWER IN bangui0.038462
LOWER IN central african republic0.038462
age 1-20.038462
LOWER IN age 0-10.038462
bangladesh0.038462
el salvador0.038462
LOWER IN lima0.038462
LOWER IN shantytown0.038462
LOWER IN hmong0.038462
cecum0.038462
LOWER IN short bowel syndrome0.038462
LOWER IN state of oklahoma0.038462
age >940.038462
age 30-500.038462
age 60-790.038462
LOWER IN age 3-60.038462
LOWER IN age 8-120.038462
new delhi0.038462
bilbao0.038462
estuary0.038462
estuary water0.038462
salinity <5 ppt0.038462
LOWER IN salinity >20 ppt0.038462
LOWER IN forearm0.038462
LOWER IN arm0.038462
forearm0.038462
equus przewalskii0.037736
tibet autonomous region0.037736
age < 3 years0.037736
south america0.037736
ruminant reticulum0.037736
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer0.750000
rural community0.714286
homosexual0.666667
gay0.666667
msm0.666667
amerindian0.666667
venezuela0.666667
LOWER IN heterosexual0.666667
LOWER IN msw0.666667
india0.666667
gorilla gorilla0.666667
LOWER IN united states of america0.625000
przewalski horse0.500000
himalayas0.500000
raute0.500000
denver0.500000
chuquisaca department0.500000
age 5-13 years0.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
myanmar0.500000
thailand0.500000
karen0.500000
kebbi state0.500000
age 10-15 years0.500000
schistosomiasis0.500000
urinary schistosomiasis0.500000
hadza0.500000
estonia0.500000
LOWER IN russia0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
age 130.500000
age 19-240.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
gorilla0.500000
africa0.500000
antananarivo0.500000
madagascar0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
age 1-20.500000
LOWER IN age 0-10.500000
mongolian sheep0.500000
bangladesh0.500000
small village0.500000
tunapuco0.500000
el salvador0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
LOWER IN hmong0.500000
cecum0.500000
LOWER IN short bowel syndrome0.500000
LOWER IN state of oklahoma0.500000
age >940.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
new delhi0.500000
bilbao0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
LOWER IN salinity >20 ppt0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
LOWER IN mouth mucosa0.500000
forearm0.500000
zoological garden0.400000
equus przewalskii0.333333
nepal0.333333
tibet autonomous region0.333333
egypt0.333333
nigeria0.333333
tanzania0.333333
age < 3 years0.333333
south america0.333333
ruminant reticulum0.333333
omasum0.333333
peru0.333333
LOWER IN city0.333333
LOWER IN saline water0.333333
arm0.333333
child0.294118
state of colorado0.285714
bolivia0.250000
biopsy site0.250000
juvenile organism0.250000
LOWER IN finland0.250000
LOWER IN diarrhea0.250000
LOWER IN china0.250000
LOWER IN age < 1 year0.250000
small intestine0.250000
rectum0.222222
biopsy0.200000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.880000
homo sapiens0.880000
rural community0.240000
child0.240000
adult0.220000
united states of america0.200000
LOWER IN united states of america0.100000
hunter gatherer0.100000
china0.100000
state of colorado0.080000
homosexual0.080000
gay0.080000
msm0.080000
city0.080000
chuquisaca department0.080000
bolivia0.080000
age 5-13 years0.080000
obsolete_juvenile stage0.080000
india0.080000
zoological garden0.060000
amerindian0.060000
venezuela0.060000
thailand0.060000
control0.060000
small village0.060000
himalayas0.040000
nepal0.040000
denver0.040000
rectum0.040000
LOWER IN feces0.040000
LOWER IN heterosexual0.040000
LOWER IN msw0.040000
myanmar0.040000
karen0.040000
egypt0.040000
nigeria0.040000
kebbi state0.040000
age 10-15 years0.040000
tanzania0.040000
hadza0.040000
infant0.040000
LOWER IN age 30-500.040000
LOWER IN age 60-790.040000
gorilla gorilla0.040000
africa0.040000
mongolian sheep0.040000
ovis aries0.040000
peru0.040000
tunapuco0.040000
LOWER IN city0.040000
LOWER IN mouth mucosa0.040000
LOWER IN mouth0.040000
equus przewalskii0.020000
przewalski horse0.020000
hiv infection0.020000
LOWER IN control0.020000
raute0.020000
ulcerative colitis0.020000
biopsy0.020000
biopsy site0.020000
tibet autonomous region0.020000
tibetan plateau0.020000
LOWER IN gangcha region0.020000
gannan tibetan autonomous prefecture0.020000
female0.020000
schistosomiasis0.020000
urinary schistosomiasis0.020000
age < 3 years0.020000
estonia0.020000
LOWER IN russia0.020000
south america0.020000
low income0.020000
LOWER IN sewer0.020000
LOWER IN wastewater treatment plant0.020000
age 130.020000
juvenile organism0.020000
LOWER IN finland0.020000
brazil0.020000
age 19-240.020000
LOWER IN adult0.020000
LOWER IN age >940.020000
soldiers0.020000
french republic0.020000
monkey0.020000
gorilla0.020000
antananarivo0.020000
madagascar0.020000
LOWER IN bangui0.020000
LOWER IN central african republic0.020000
age0.020000
age 1-20.020000
LOWER IN age 0-10.020000
rumen0.020000
ruminant reticulum0.020000
omasum0.020000
male0.020000
LOWER IN female0.020000
bangladesh0.020000
LOWER IN diarrhea0.020000
el salvador0.020000
Exp. ID User ID Description Date Region Flag Sequences
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 113
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, china, ovis aries2017-04-09v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
111amnoncommon mongolian sheep, china, ovis aries, rectum, ileum, cecum, colon2017-04-09v4No1 / 330
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org