Search result for sequence:
TACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGCGGCGTAAGTCAGTTGTGAAATCGTGCGGCTTAACCGTGCAATTGCAGTTGATACTGCGTCGCTTGAGTGCACACAGGGATGTTGGAATTCATGG
common ontology terms
term enrichment score
TermScore
rural community0.348837
homo sapiens0.284928
child0.240000
feces0.231242
homosexual0.200000
msm0.200000
hunter gatherer0.170455
LOWER IN united states of america0.166667
adult0.148093
gay0.137931
india0.137931
chuquisaca department0.133333
age 5-13 years0.125000
state of colorado0.121212
bolivia0.117647
obsolete_juvenile stage0.111111
male0.109091
amerindian0.106195
venezuela0.106195
small village0.103448
thailand0.098361
hiv infection0.096000
zoological garden0.093750
city0.093023
united states of america0.080000
LOWER IN heterosexual0.072727
LOWER IN msw0.072727
gorilla gorilla0.072727
himalayas0.071429
denver0.071429
rectal swab0.071429
myanmar0.071429
karen0.071429
kebbi state0.071429
age 10-15 years0.071429
hadza0.071429
LOWER IN age 30-500.071429
LOWER IN age 60-790.071429
africa0.071429
mongolian sheep0.071429
tunapuco0.071429
LOWER IN mouth mucosa0.071429
nepal0.068966
nigeria0.068966
tanzania0.068966
peru0.068966
LOWER IN city0.068966
rectum0.065574
egypt0.064516
ovis aries0.062500
LOWER IN mouth0.060606
LOWER IN feces0.059701
infant0.057143
china0.037106
przewalski horse0.037037
raute0.037037
LOWER IN gangcha region0.037037
gannan tibetan autonomous prefecture0.037037
urinary schistosomiasis0.037037
schistosomiasis0.037037
estonia0.037037
LOWER IN russia0.037037
low income0.037037
LOWER IN sewer0.037037
LOWER IN wastewater treatment plant0.037037
age 130.037037
age 19-240.037037
LOWER IN age >940.037037
soldiers0.037037
gorilla0.037037
antananarivo0.037037
madagascar0.037037
LOWER IN bangui0.037037
LOWER IN central african republic0.037037
age 1-20.037037
LOWER IN age 0-10.037037
bangladesh0.037037
el salvador0.037037
LOWER IN lima0.037037
LOWER IN shantytown0.037037
LOWER IN hmong0.037037
cecum0.037037
LOWER IN short bowel syndrome0.037037
LOWER IN state of oklahoma0.037037
age >940.037037
age 30-500.037037
age 60-790.037037
LOWER IN age 3-60.037037
LOWER IN age 8-120.037037
new delhi0.037037
estuary0.037037
estuary water0.037037
salinity <5 ppt0.037037
LOWER IN salinity >20 ppt0.037037
bilbao0.037037
LOWER IN arm0.037037
LOWER IN forearm0.037037
forearm0.037037
tibet autonomous region0.036364
age < 3 years0.036364
Fraction of dbbact annotations with this term covered by the query
TermScore
male1.000000
homosexual0.750000
msm0.750000
hunter gatherer0.750000
rural community0.714286
gay0.666667
amerindian0.666667
venezuela0.666667
LOWER IN heterosexual0.666667
LOWER IN msw0.666667
india0.666667
gorilla gorilla0.666667
LOWER IN united states of america0.625000
przewalski horse0.500000
himalayas0.500000
raute0.500000
denver0.500000
rectal swab0.500000
chuquisaca department0.500000
LOWER IN gangcha region0.500000
gannan tibetan autonomous prefecture0.500000
myanmar0.500000
karen0.500000
kebbi state0.500000
age 10-15 years0.500000
urinary schistosomiasis0.500000
schistosomiasis0.500000
hadza0.500000
estonia0.500000
LOWER IN russia0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
age 130.500000
age 19-240.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
gorilla0.500000
africa0.500000
antananarivo0.500000
madagascar0.500000
LOWER IN bangui0.500000
LOWER IN central african republic0.500000
age 1-20.500000
LOWER IN age 0-10.500000
mongolian sheep0.500000
bangladesh0.500000
small village0.500000
tunapuco0.500000
el salvador0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
LOWER IN hmong0.500000
cecum0.500000
LOWER IN short bowel syndrome0.500000
LOWER IN state of oklahoma0.500000
age >940.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
new delhi0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
LOWER IN salinity >20 ppt0.500000
bilbao0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN mouth mucosa0.500000
forearm0.500000
nepal0.333333
age 5-13 years0.333333
tibet autonomous region0.333333
thailand0.333333
nigeria0.333333
tanzania0.333333
age < 3 years0.333333
south america0.333333
ruminant reticulum0.333333
omasum0.333333
peru0.333333
LOWER IN city0.333333
LOWER IN saline water0.333333
arm0.333333
hiv infection0.285714
state of colorado0.285714
equus przewalskii0.250000
zoological garden0.250000
child0.250000
bolivia0.250000
biopsy site0.250000
juvenile organism0.250000
LOWER IN finland0.250000
LOWER IN diarrhea0.250000
LOWER IN china0.250000
LOWER IN age < 1 year0.250000
small intestine0.250000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.884615
homo sapiens0.884615
united states of america0.230769
rural community0.230769
child0.230769
adult0.211538
homosexual0.115385
msm0.115385
LOWER IN united states of america0.096154
hunter gatherer0.096154
china0.096154
state of colorado0.076923
gay0.076923
city0.076923
age 5-13 years0.076923
bolivia0.076923
chuquisaca department0.076923
obsolete_juvenile stage0.076923
india0.076923
zoological garden0.057692
hiv infection0.057692
male0.057692
amerindian0.057692
venezuela0.057692
thailand0.057692
control0.057692
small village0.057692
LOWER IN control0.038462
himalayas0.038462
nepal0.038462
denver0.038462
rectal swab0.038462
rectum0.038462
LOWER IN feces0.038462
LOWER IN heterosexual0.038462
LOWER IN msw0.038462
myanmar0.038462
karen0.038462
egypt0.038462
nigeria0.038462
kebbi state0.038462
age 10-15 years0.038462
tanzania0.038462
hadza0.038462
infant0.038462
LOWER IN age 30-500.038462
LOWER IN age 60-790.038462
gorilla gorilla0.038462
africa0.038462
mongolian sheep0.038462
ovis aries0.038462
peru0.038462
tunapuco0.038462
LOWER IN city0.038462
LOWER IN mouth mucosa0.038462
LOWER IN mouth0.038462
equus przewalskii0.019231
przewalski horse0.019231
raute0.019231
biopsy0.019231
biopsy site0.019231
ulcerative colitis0.019231
tibet autonomous region0.019231
tibetan plateau0.019231
LOWER IN gangcha region0.019231
gannan tibetan autonomous prefecture0.019231
female0.019231
urinary schistosomiasis0.019231
schistosomiasis0.019231
age < 3 years0.019231
estonia0.019231
LOWER IN russia0.019231
south america0.019231
low income0.019231
LOWER IN sewer0.019231
LOWER IN wastewater treatment plant0.019231
age 130.019231
juvenile organism0.019231
LOWER IN finland0.019231
brazil0.019231
age 19-240.019231
LOWER IN adult0.019231
LOWER IN age >940.019231
soldiers0.019231
french republic0.019231
monkey0.019231
gorilla0.019231
antananarivo0.019231
madagascar0.019231
LOWER IN bangui0.019231
LOWER IN central african republic0.019231
age0.019231
age 1-20.019231
LOWER IN age 0-10.019231
rumen0.019231
ruminant reticulum0.019231
omasum0.019231
LOWER IN female0.019231
bangladesh0.019231
LOWER IN diarrhea0.019231
Exp. ID User ID Description Date Region Flag Sequences
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
563amnon high in hiv infection compared to control in homosexual msm male united states of america rectal swab feces homo sapiens 2019-11-18v4No1 / 100
563amnoncommon hiv infection, homosexual, msm, male, united states of america, rectal swab, feces, homo sapiens2019-11-18v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org