Search result for sequence:
TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGTCCTTTAAGCGTGCTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGAGGACTTGAGTACGCACGAGGTAGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
china0.205128
state of texas0.181818
poland0.173913
quail0.146341
coturnix coturnix0.146341
kingdom of spain0.103896
homo sapiens0.103290
LOWER IN age >940.102564
LOWER IN tenth decade human stage0.102564
estuary water0.102564
salinity <5 ppt0.102564
bilbao0.102564
czech republic0.101695
age < 3 years0.097561
LOWER IN ninth decade human stage0.097561
fourth decade human stage0.095238
obese body mass index status0.093023
estuary0.093023
feces0.089769
rectum0.086957
adult0.083990
obesity0.081633
low bmi0.075472
LOWER IN russia0.072727
irritable bowel syndrome0.055556
colorectal adenocarcinoma0.054054
colorectal cancer0.054054
oslo0.054054
low anterior resection0.054054
taipei city0.054054
age 8-120.054054
age 13-140.054054
LOWER IN age 3-60.054054
soldiers0.054054
LOWER IN himalayas0.054054
LOWER IN short bowel syndrome0.054054
perianal skin0.054054
santa catalina island0.054054
urocyon littoralis0.054054
urocyon littoralis catalinae0.054054
santa catalina island fox0.054054
LOWER IN salinity &gt;20 ppt0.054054
carcinoma0.052632
14-year-old human stage0.052632
estonia0.052632
65-79 year-old human stage0.052632
LOWER IN 65-79 year-old human stage0.052632
LOWER IN nepal0.052632
LOWER IN colon0.052632
LOWER IN venezuela0.052632
LOWER IN amerindian0.052632
united states of america0.051565
amsterdam0.051282
taiwan0.051282
13-year-old human stage0.051282
fifth decade human stage0.051282
LOWER IN fifth decade human stage0.051282
LOWER IN left colon0.051282
LOWER IN external acoustic meatus0.051282
LOWER IN ear canal0.051282
LOWER IN hunter gatherer0.051282
water0.051064
heterosexual0.050000
msw0.050000
6-12 year-old child stage0.050000
young adult stage0.050000
jejunum0.050000
LOWER IN right colon0.050000
LOWER IN fasting0.048780
LOWER IN homosexual0.048780
LOWER IN msm0.048780
kingdom of the netherlands0.048780
bronchoalveolar lavage0.047619
finland0.047619
LOWER IN fourth decade human stage0.047619
kingdom of norway0.046512
belgium0.046512
infant0.045977
LOWER IN switzerland0.045455
early timepoints0.045455
LOWER IN late timepoints0.044444
lung0.044444
LOWER IN 2-5 year-old child stage0.043478
LOWER IN rural community0.043478
duodenum0.043478
fresh water0.043011
crohn's disease0.042553
river0.042553
LOWER IN crohn&#39;s disease0.042553
caecum0.041958
autumn0.041667
ileum0.039216
sus scrofa0.039216
pig0.039216
city0.036364
united kingdom0.034483
wild0.033898
male0.029412
control0.029126
LOWER IN caecum0.028169
Fraction of dbbact annotations with this term covered by the query
TermScore
irritable bowel syndrome1.000000
china1.000000
colorectal adenocarcinoma0.500000
colorectal cancer0.500000
oslo0.500000
quail0.500000
coturnix coturnix0.500000
low anterior resection0.500000
taipei city0.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
LOWER IN age &gt;940.500000
LOWER IN tenth decade human stage0.500000
soldiers0.500000
LOWER IN himalayas0.500000
estuary water0.500000
salinity <5 ppt0.500000
bilbao0.500000
LOWER IN short bowel syndrome0.500000
perianal skin0.500000
santa catalina island0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
LOWER IN salinity &gt;20 ppt0.500000
carcinoma0.333333
age < 3 years0.333333
14-year-old human stage0.333333
estonia0.333333
65-79 year-old human stage0.333333
LOWER IN ninth decade human stage0.333333
LOWER IN 65-79 year-old human stage0.333333
LOWER IN nepal0.333333
LOWER IN colon0.333333
LOWER IN venezuela0.333333
LOWER IN amerindian0.333333
fourth decade human stage0.285714
obese body mass index status0.250000
state of texas0.250000
amsterdam0.250000
taiwan0.250000
13-year-old human stage0.250000
fifth decade human stage0.250000
LOWER IN fifth decade human stage0.250000
estuary0.250000
LOWER IN left colon0.250000
LOWER IN external acoustic meatus0.250000
LOWER IN ear canal0.250000
LOWER IN hunter gatherer0.250000
heterosexual0.200000
msw0.200000
6-12 year-old child stage0.200000
young adult stage0.200000
jejunum0.200000
LOWER IN right colon0.200000
rectum0.181818
LOWER IN fasting0.166667
LOWER IN homosexual0.166667
LOWER IN msm0.166667
kingdom of the netherlands0.166667
poland0.153846
obesity0.142857
bronchoalveolar lavage0.142857
finland0.142857
LOWER IN fourth decade human stage0.142857
czech republic0.125000
kingdom of norway0.125000
belgium0.125000
low bmi0.111111
LOWER IN switzerland0.111111
early timepoints0.111111
LOWER IN late timepoints0.100000
lung0.100000
LOWER IN russia0.100000
kingdom of spain0.095238
LOWER IN 2-5 year-old child stage0.090909
LOWER IN rural community0.090909
duodenum0.090909
crohn's disease0.083333
river0.083333
LOWER IN crohn&#39;s disease0.083333
autumn0.076923
ileum0.062500
sus scrofa0.062500
pig0.062500
homo sapiens0.055351
city0.050000
feces0.047771
adult0.046243
united kingdom0.043478
wild0.041667
infant0.038462
water0.036364
fresh water0.034483
male0.030303
united states of america0.028340
caecum0.027778
LOWER IN caecum0.027778
LOWER IN saline water0.024390
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.771429
feces0.742857
adult0.457143
united states of america0.285714
poland0.200000
control0.142857
state of texas0.142857
kingdom of spain0.114286
china0.114286
LOWER IN control0.085714
czech republic0.085714
research facility0.085714
caecum0.085714
quail0.085714
coturnix coturnix0.085714
water0.085714
obesity0.057143
obese body mass index status0.057143
low bmi0.057143
fourth decade human stage0.057143
LOWER IN russia0.057143
infant0.057143
age < 3 years0.057143
LOWER IN age &gt;940.057143
LOWER IN ninth decade human stage0.057143
LOWER IN tenth decade human stage0.057143
rectum0.057143
estuary0.057143
fresh water0.057143
estuary water0.057143
salinity <5 ppt0.057143
bilbao0.057143
carcinoma0.028571
colorectal adenocarcinoma0.028571
colorectal cancer0.028571
irritable bowel syndrome0.028571
kingdom of norway0.028571
oslo0.028571
crohn's disease0.028571
belgium0.028571
LOWER IN switzerland0.028571
early timepoints0.028571
LOWER IN fasting0.028571
LOWER IN late timepoints0.028571
lung0.028571
bronchoalveolar lavage0.028571
heterosexual0.028571
msw0.028571
LOWER IN homosexual0.028571
LOWER IN msm0.028571
male0.028571
kingdom of the netherlands0.028571
amsterdam0.028571
low anterior resection0.028571
taipei city0.028571
taiwan0.028571
finland0.028571
age 8-120.028571
age 13-140.028571
6-12 year-old child stage0.028571
13-year-old human stage0.028571
14-year-old human stage0.028571
LOWER IN age 3-60.028571
LOWER IN 2-5 year-old child stage0.028571
estonia0.028571
65-79 year-old human stage0.028571
fifth decade human stage0.028571
female0.028571
soldiers0.028571
young adult stage0.028571
LOWER IN adult0.028571
LOWER IN 65-79 year-old human stage0.028571
LOWER IN fourth decade human stage0.028571
LOWER IN fifth decade human stage0.028571
LOWER IN nepal0.028571
LOWER IN himalayas0.028571
LOWER IN rural community0.028571
LOWER IN short bowel syndrome0.028571
river0.028571
autumn0.028571
LOWER IN colon0.028571
duodenum0.028571
jejunum0.028571
ileum0.028571
LOWER IN caecum0.028571
LOWER IN left colon0.028571
LOWER IN right colon0.028571
sus scrofa0.028571
pig0.028571
united kingdom0.028571
LOWER IN crohn&#39;s disease0.028571
perianal skin0.028571
LOWER IN external acoustic meatus0.028571
LOWER IN ear canal0.028571
wild0.028571
santa catalina island0.028571
urocyon littoralis0.028571
urocyon littoralis catalinae0.028571
santa catalina island fox0.028571
city0.028571
Exp. ID User ID Description Date Region Flag Sequences
239amnon high in carcinoma colorectal adenocarcinoma colorectal cancer compared to control in feces homo sapiens united states of america 2017-11-08v4No1 / 6
532amnondominant feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 16
294amnondominant feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (dominant feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 18
663amnondominant feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 18
663amnondominant feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 18
330amnondominant feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 21
319amnondominant feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 28
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
663amnon high in poland compared to switzerland in feces homo sapiens adult 2020-09-22v4No1 / 72
108amnondecreases during fasting in quail caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum state of texas quail coturnix coturnix )2017-04-07v4No1 / 76
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
629amnon high in heterosexual msw compared to homosexual msm in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 85
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 98
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage compared to age 3-6 2-5 year-old child stage in feces homo sapiens china )2018-12-30v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
108amnoncommon united states of america, research facility, caecum, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 216
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in soldiers young adult stage compared to adult age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 238
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
108amnon high in caecum compared to colon in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592

Problems / suggestions? Please email info AT dbbact DOT org