Search result for sequence:
TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCCCCTTAAGCGTGTTGTGAAATGCGGGTGCTCAACATCCGACTTGCAGCGCGAACTGGGGGGCTTGAGTGCGCCGAAAGTAGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
mouth0.419580
subgingival plaque0.368421
saliva0.350061
dentition0.337719
homo sapiens0.222700
bolivia0.166667
africa0.153846
adult0.132388
cold environment0.130435
mouth mucosa0.130435
chuquisaca department0.130435
age 5-13 years0.122449
oral cavity0.118812
child0.116183
rainbow trout0.115385
oncorhynchus mykiss0.115385
brazil0.114286
state of california0.102564
LOWER IN feces0.093750
gastrointestinal system mucosa0.090909
12c0.090909
LOWER IN warm temperature habitat0.090909
san diego0.090909
shallow pocket depth0.090909
depth < 3mm0.090909
stunted growth0.090909
duodenum0.089552
rural community0.089552
sichuan province0.086957
mouth neoplasm0.086957
cancer0.086957
sweden0.085714
LOWER IN saliva0.081633
fish0.075949
periodontitis0.068966
obsolete_juvenile stage0.066667
australia0.052632
digestive system0.048387
LOWER IN 18c0.047619
older age0.047619
LOWER IN younger age0.047619
gut content0.047619
temp 12c0.047619
LOWER IN temp 18c0.047619
LOWER IN cheek0.047619
periodontal pocket0.047619
depth > 3mm0.047619
deep pocket depth0.047619
cameroon0.047619
antananarivo0.047619
madagascar0.047619
central african republic0.047619
bangui0.047619
anas platyrhynchos0.047619
mallard0.047619
LOWER IN influenza0.047619
LOWER IN arm0.047619
LOWER IN forearm0.047619
moscow0.047619
sigmoid colon0.047619
children0.047619
forearm0.047619
atlanta0.046512
amsterdam0.046512
state of new york0.046512
venezuela0.046512
amerindian0.046512
graz city district0.046512
terminal ileum0.046512
arm0.046512
china0.046154
supragingival plaque0.045455
hunter gatherer0.045455
caecum0.045455
body mass index0.044444
united states of america0.044444
south korea0.044444
cloaca0.044444
russia0.044444
control0.044199
obesity0.043478
austria0.043478
LOWER IN skin0.043478
biopsy0.043478
high bmi0.041667
LOWER IN crohn&#39;s disease0.040816
rectum0.040000
italy0.039216
germany0.037736
stomach0.037037
age0.033898
colon0.033898
skin0.029851
LOWER IN control0.022222
research facility0.016484
Fraction of dbbact annotations with this term covered by the query
TermScore
subgingival plaque0.700000
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
older age0.500000
LOWER IN younger age0.500000
gut content0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
LOWER IN cheek0.500000
san diego0.500000
periodontal pocket0.500000
shallow pocket depth0.500000
depth < 3mm0.500000
depth > 3mm0.500000
deep pocket depth0.500000
mouth mucosa0.500000
stunted growth0.500000
cameroon0.500000
bolivia0.500000
antananarivo0.500000
madagascar0.500000
central african republic0.500000
bangui0.500000
anas platyrhynchos0.500000
mallard0.500000
LOWER IN influenza0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
moscow0.500000
sigmoid colon0.500000
children0.500000
forearm0.500000
mouth0.476190
dentition0.437500
saliva0.379310
atlanta0.333333
amsterdam0.333333
state of new york0.333333
sichuan province0.333333
africa0.333333
venezuela0.333333
amerindian0.333333
graz city district0.333333
age 5-13 years0.333333
mouth neoplasm0.333333
cancer0.333333
terminal ileum0.333333
arm0.333333
oral cavity0.285714
rainbow trout0.250000
oncorhynchus mykiss0.250000
supragingival plaque0.250000
hunter gatherer0.250000
caecum0.250000
LOWER IN saliva0.222222
body mass index0.200000
south korea0.200000
cloaca0.200000
russia0.200000
obesity0.166667
austria0.166667
LOWER IN skin0.166667
biopsy0.166667
brazil0.133333
homo sapiens0.127072
high bmi0.125000
LOWER IN feces0.125000
periodontitis0.111111
duodenum0.111111
rural community0.111111
LOWER IN crohn&#39;s disease0.111111
state of california0.105263
sweden0.100000
obsolete_juvenile stage0.100000
rectum0.100000
italy0.090909
child0.086957
adult0.081633
fish0.076923
germany0.076923
stomach0.071429
australia0.055556
age0.052632
colon0.052632
skin0.037037
digestive system0.035714
control0.028369
china0.028302
united states of america0.025000
LOWER IN control0.014286
research facility0.009259
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.900000
mouth0.375000
adult0.350000
saliva0.325000
dentition0.275000
subgingival plaque0.250000
united states of america0.200000
child0.175000
china0.125000
brazil0.100000
control0.100000
state of california0.100000
africa0.100000
bolivia0.100000
sweden0.075000
fish0.075000
rainbow trout0.075000
oncorhynchus mykiss0.075000
research facility0.075000
digestive system0.075000
cold environment0.075000
oral cavity0.075000
mouth mucosa0.075000
duodenum0.075000
age 5-13 years0.075000
rural community0.075000
chuquisaca department0.075000
LOWER IN feces0.075000
gastrointestinal system mucosa0.050000
12c0.050000
LOWER IN warm temperature habitat0.050000
obsolete_juvenile stage0.050000
australia0.050000
LOWER IN control0.050000
LOWER IN saliva0.050000
san diego0.050000
shallow pocket depth0.050000
depth < 3mm0.050000
periodontitis0.050000
sichuan province0.050000
stunted growth0.050000
mouth neoplasm0.050000
cancer0.050000
LOWER IN 18c0.025000
age0.025000
older age0.025000
LOWER IN younger age0.025000
italy0.025000
high bmi0.025000
body mass index0.025000
obesity0.025000
gut content0.025000
temp 12c0.025000
LOWER IN temp 18c0.025000
atlanta0.025000
LOWER IN cheek0.025000
south korea0.025000
periodontal pocket0.025000
depth > 3mm0.025000
deep pocket depth0.025000
supragingival plaque0.025000
amsterdam0.025000
state of new york0.025000
stomach0.025000
cameroon0.025000
antananarivo0.025000
madagascar0.025000
central african republic0.025000
bangui0.025000
venezuela0.025000
amerindian0.025000
hunter gatherer0.025000
austria0.025000
graz city district0.025000
anas platyrhynchos0.025000
mallard0.025000
cloaca0.025000
LOWER IN influenza0.025000
LOWER IN skin0.025000
LOWER IN arm0.025000
LOWER IN forearm0.025000
germany0.025000
russia0.025000
moscow0.025000
rectum0.025000
terminal ileum0.025000
sigmoid colon0.025000
caecum0.025000
colon0.025000
biopsy0.025000
children0.025000
LOWER IN crohn&#39;s disease0.025000
skin0.025000
arm0.025000
forearm0.025000
Exp. ID User ID Description Date Region Flag Sequences
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 15
203amnonpositively correlated with age in child dental plaque ( high in age older age compared to younger age in homo sapiens oral cavity obsolete_juvenile stage dentition australia mouth )2017-10-01v4No1 / 28
246amnon high in high bmi body mass index obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
102amnonhigher in teeth compared to cheeks, saliva ( high in dentition compared to saliva cheek in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 63
272amnoncommon in subgingival plaque in south korea (common homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 65
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 69
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 80
203amnoncommon homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 81
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 84
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 86
278amnoncommon homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 96
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
594amnoncommon adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 113
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 131
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 153
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
517amnon high in mouth mucosa mouth compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 162
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
104amnoncommon homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 227
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836

Problems / suggestions? Please email info AT dbbact DOT org