Search result for sequence:
TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCCCCTTAAGCGTGTTGTGAAATGCGGGTGCTCAACATCCGACTTGCAGCGCGAACTGGGGGGCTTGAGTGCGCCGAAAGTAGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
mouth0.425532
subgingival plaque0.375335
dentition0.351598
saliva0.347826
homo sapiens0.229748
africa0.170213
bolivia0.170213
cold environment0.133333
mouth mucosa0.133333
chuquisaca department0.133333
adult0.133333
child0.128440
oral cavity0.125000
age 5-13 years0.125000
brazil0.119403
rainbow trout0.117647
oncorhynchus mykiss0.117647
state of california0.103896
rural community0.100000
LOWER IN feces0.097561
gastrointestinal system mucosa0.093023
12c0.093023
LOWER IN warm temperature habitat0.093023
san diego0.093023
shallow pocket depth0.093023
depth < 3mm0.093023
stunted growth0.093023
sweden0.090909
duodenum0.090909
sichuan province0.088889
mouth neoplasm0.088889
cancer0.088889
fish0.083333
LOWER IN saliva0.083333
periodontitis0.070175
obsolete_juvenile stage0.067797
australia0.057971
china0.052448
digestive system0.050000
LOWER IN 18c0.048780
older age0.048780
LOWER IN younger age0.048780
gut content0.048780
temp 12c0.048780
LOWER IN temp 18c0.048780
LOWER IN cheek0.048780
periodontal pocket0.048780
depth > 3mm0.048780
deep pocket depth0.048780
amsterdam0.048780
antananarivo0.048780
madagascar0.048780
central african republic0.048780
bangui0.048780
anas platyrhynchos0.048780
mallard0.048780
LOWER IN influenza0.048780
LOWER IN arm0.048780
LOWER IN forearm0.048780
moscow0.048780
sigmoid colon0.048780
children0.048780
forearm0.048780
control0.047619
atlanta0.047619
state of new york0.047619
venezuela0.047619
amerindian0.047619
graz city district0.047619
terminal ileum0.047619
arm0.047619
united states of america0.047309
supragingival plaque0.046512
hunter gatherer0.046512
body mass index0.045455
south korea0.045455
cloaca0.045455
russia0.045455
obesity0.044444
austria0.044444
LOWER IN skin0.044444
biopsy0.044444
high bmi0.042553
rectum0.041667
LOWER IN crohn's disease0.041667
italy0.040816
germany0.040000
stomach0.038462
age0.034483
colon0.034483
caecum0.032787
skin0.031250
LOWER IN control0.023952
research facility0.018182
Fraction of dbbact annotations with this term covered by the query
TermScore
subgingival plaque0.700000
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
older age0.500000
LOWER IN younger age0.500000
gut content0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
LOWER IN cheek0.500000
san diego0.500000
periodontal pocket0.500000
shallow pocket depth0.500000
depth < 3mm0.500000
depth > 3mm0.500000
deep pocket depth0.500000
mouth mucosa0.500000
amsterdam0.500000
africa0.500000
stunted growth0.500000
bolivia0.500000
antananarivo0.500000
madagascar0.500000
central african republic0.500000
bangui0.500000
anas platyrhynchos0.500000
mallard0.500000
LOWER IN influenza0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
moscow0.500000
sigmoid colon0.500000
children0.500000
forearm0.500000
mouth0.476190
dentition0.466667
saliva0.400000
oral cavity0.333333
atlanta0.333333
state of new york0.333333
sichuan province0.333333
venezuela0.333333
amerindian0.333333
graz city district0.333333
age 5-13 years0.333333
mouth neoplasm0.333333
cancer0.333333
terminal ileum0.333333
arm0.333333
rainbow trout0.250000
oncorhynchus mykiss0.250000
supragingival plaque0.250000
hunter gatherer0.250000
LOWER IN saliva0.222222
body mass index0.200000
south korea0.200000
cloaca0.200000
russia0.200000
obesity0.166667
austria0.166667
LOWER IN skin0.166667
biopsy0.166667
brazil0.142857
rural community0.142857
LOWER IN feces0.133333
homo sapiens0.131737
high bmi0.125000
sweden0.111111
periodontitis0.111111
duodenum0.111111
rectum0.111111
LOWER IN crohn's disease0.111111
state of california0.105263
obsolete_juvenile stage0.100000
italy0.100000
child0.100000
fish0.090909
germany0.090909
adult0.083333
stomach0.076923
australia0.066667
age0.052632
colon0.052632
caecum0.045455
skin0.040000
digestive system0.037037
china0.032967
control0.031008
united states of america0.026738
LOWER IN control0.015625
research facility0.010309
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.897436
mouth0.384615
adult0.333333
saliva0.307692
dentition0.282051
subgingival plaque0.256410
united states of america0.205128
child0.179487
china0.128205
brazil0.102564
control0.102564
state of california0.102564
africa0.102564
bolivia0.102564
sweden0.076923
fish0.076923
rainbow trout0.076923
oncorhynchus mykiss0.076923
research facility0.076923
digestive system0.076923
cold environment0.076923
oral cavity0.076923
mouth mucosa0.076923
duodenum0.076923
age 5-13 years0.076923
rural community0.076923
chuquisaca department0.076923
LOWER IN feces0.076923
gastrointestinal system mucosa0.051282
12c0.051282
LOWER IN warm temperature habitat0.051282
obsolete_juvenile stage0.051282
australia0.051282
LOWER IN control0.051282
LOWER IN saliva0.051282
san diego0.051282
shallow pocket depth0.051282
depth < 3mm0.051282
periodontitis0.051282
sichuan province0.051282
stunted growth0.051282
mouth neoplasm0.051282
cancer0.051282
LOWER IN 18c0.025641
age0.025641
older age0.025641
LOWER IN younger age0.025641
italy0.025641
high bmi0.025641
body mass index0.025641
obesity0.025641
gut content0.025641
temp 12c0.025641
LOWER IN temp 18c0.025641
atlanta0.025641
LOWER IN cheek0.025641
south korea0.025641
periodontal pocket0.025641
depth > 3mm0.025641
deep pocket depth0.025641
supragingival plaque0.025641
amsterdam0.025641
state of new york0.025641
stomach0.025641
antananarivo0.025641
madagascar0.025641
central african republic0.025641
bangui0.025641
venezuela0.025641
amerindian0.025641
hunter gatherer0.025641
austria0.025641
graz city district0.025641
anas platyrhynchos0.025641
mallard0.025641
cloaca0.025641
LOWER IN influenza0.025641
LOWER IN skin0.025641
LOWER IN arm0.025641
LOWER IN forearm0.025641
germany0.025641
russia0.025641
moscow0.025641
rectum0.025641
terminal ileum0.025641
sigmoid colon0.025641
caecum0.025641
colon0.025641
biopsy0.025641
children0.025641
LOWER IN crohn's disease0.025641
skin0.025641
arm0.025641
forearm0.025641
Exp. ID User ID Description Date Region Flag Sequences
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 15
203amnonpositively correlated with age in child dental plaque ( high in age older age compared to younger age in homo sapiens oral cavity obsolete_juvenile stage dentition australia mouth )2017-10-01v4No1 / 28
246amnon high in high bmi body mass index obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
102amnonhigher in teeth compared to cheeks, saliva ( high in dentition compared to saliva cheek in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 63
272amnoncommon in subgingival plaque in south korea (common homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 65
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 69
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 80
203amnoncommon homo sapiens, oral cavity, obsolete_juvenile stage, dentition, australia, mouth2017-10-01v4No1 / 81
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 84
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, san diego, dentition, supragingival plaque, mouth)2017-07-13v4No1 / 86
278amnoncommon homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 96
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 131
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 153
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
517amnon high in mouth mucosa mouth compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 162
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
104amnoncommon homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 227
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836

Problems / suggestions? Please email info AT dbbact DOT org