Search result for sequence:
TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.603708
feces0.551769
adult0.355530
united states of america0.269205
child0.198511
china0.169753
rural community0.154506
canis lupus familiaris0.130025
city0.109976
infant0.105336
control0.102011
dog0.098171
sus scrofa0.093567
pig0.093567
obsolete_juvenile stage0.081522
hunter gatherer0.071856
india0.071429
female0.071307
zoological garden0.071006
state of colorado0.064016
jiangsu province0.060773
colombia0.060514
farm0.056391
amerindian0.054299
venezuela0.054299
himalayas0.053571
africa0.053571
nepal0.052174
water0.049020
small village0.048682
LOWER IN united states of america0.048368
state of tennessee0.047337
united kingdom0.045198
caecum0.042781
nigeria0.042618
biopsy0.042467
chuquisaca department0.042169
age 5-13 years0.042169
research facility0.041696
age0.041543
state of california0.040609
bolivia0.040462
river0.040462
skin0.038889
msm0.036697
gay0.036697
homosexual0.036697
tibet autonomous region0.036697
state of michigan0.036530
south korea0.036364
biopsy site0.036364
kingdom of denmark0.036364
rectum0.036199
duodenum0.035928
kingdom of norway0.035928
kingdom of spain0.034483
fresh water0.034091
LOWER IN control0.032184
age < 3 years0.030722
thailand0.030488
left colon0.030488
nanchang city prefecture0.030488
kebbi state0.030488
age 10-15 years0.030488
right colon0.030257
monkey0.030181
italy0.029369
wastewater treatment plant0.024742
arm0.024691
tanzania0.024691
metabolic syndrome0.024691
tonsil0.024691
LOWER IN duodenum0.024615
madagascar0.024540
antananarivo0.024540
new delhi0.024540
age 60-790.024540
age 50-60 years0.024540
nanning city prefecture0.024540
guangzhou city prefecture0.024540
oslo0.024540
age 30-500.024540
LOWER IN city0.024242
rumen0.024145
male0.023739
mouse0.020870
mus musculus0.020374
daycare0.018519
age 1-5 years0.018519
hmong0.018519
forearm0.018519
hadza0.018519
central african republic0.018519
bangui0.018519
state of arizona0.018519
tunapuco0.018519
age 19-240.018519
age one year0.018519
denver0.018519
age 30-400.018519
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.857143
colombia0.800000
hunter gatherer0.750000
small village0.750000
wastewater treatment plant0.750000
sus scrofa0.666667
pig0.666667
amerindian0.666667
venezuela0.666667
arm0.666667
tanzania0.666667
msm0.666667
gay0.666667
homosexual0.666667
tibet autonomous region0.666667
india0.666667
nigeria0.666667
age < 3 years0.666667
metabolic syndrome0.666667
tonsil0.666667
LOWER IN heterosexual0.666667
LOWER IN msw0.666667
gorilla gorilla0.666667
canis lupus familiaris0.642857
LOWER IN united states of america0.625000
zoological garden0.600000
biopsy0.600000
dog0.600000
state of michigan0.571429
LOWER IN duodenum0.571429
homo sapiens0.513333
daycare0.500000
age 1-5 years0.500000
trichuriasis0.500000
przewalski horse0.500000
south korea0.500000
waist circumference0.500000
large waist circumference0.500000
LOWER IN small waist circumference0.500000
thailand0.500000
hmong0.500000
forearm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
hadza0.500000
karen0.500000
myanmar0.500000
age >940.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
left colon0.500000
biopsy site0.500000
africa0.500000
central african republic0.500000
bangui0.500000
madagascar0.500000
antananarivo0.500000
schizophrenia0.500000
new delhi0.500000
azerbaijan0.500000
pan troglodytes0.500000
chimpanzee0.500000
nanchang city prefecture0.500000
pancreatitis0.500000
acute pancreatitis0.500000
irritable bowel syndrome0.500000
state of arizona0.500000
age 200.500000
chepang0.500000
tunapuco0.500000
age 19-240.500000
age 60-790.500000
atherosclerosis0.500000
raute0.500000
kingdom of denmark0.500000
age one year0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
guangzhou city prefecture0.500000
denver0.500000
raji0.500000
age 17-290.500000
iowa0.500000
oslo0.500000
age 30-400.500000
macaque0.500000
beagle dog0.500000
stroke0.500000
stunted growth0.500000
kebbi state0.500000
age 10-15 years0.500000
toronto0.500000
el salvador0.500000
age 130.500000
estonia0.500000
spondylitis0.500000
spondyloarthritis0.500000
cecal content0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.767296
homo sapiens0.732704
adult0.295597
united states of america0.286164
china0.172956
child0.125786
rural community0.084906
control0.081761
canis lupus familiaris0.072327
city0.062893
infant0.059748
dog0.053459
sus scrofa0.050314
pig0.050314
obsolete_juvenile stage0.047170
female0.044025
zoological garden0.037736
hunter gatherer0.037736
india0.037736
state of colorado0.034591
jiangsu province0.034591
colombia0.031447
water0.031447
research facility0.031447
farm0.031447
amerindian0.028302
venezuela0.028302
nepal0.028302
himalayas0.028302
africa0.028302
united kingdom0.025157
state of tennessee0.025157
small village0.025157
caecum0.025157
state of california0.025157
LOWER IN united states of america0.025157
LOWER IN control0.022013
skin0.022013
chuquisaca department0.022013
bolivia0.022013
age 5-13 years0.022013
biopsy0.022013
nigeria0.022013
river0.022013
age0.022013
duodenum0.018868
south korea0.018868
msm0.018868
gay0.018868
homosexual0.018868
tibet autonomous region0.018868
biopsy site0.018868
state of michigan0.018868
kingdom of spain0.018868
kingdom of denmark0.018868
kingdom of norway0.018868
rectum0.018868
fresh water0.018868
thailand0.015723
left colon0.015723
nanchang city prefecture0.015723
right colon0.015723
age < 3 years0.015723
kebbi state0.015723
age 10-15 years0.015723
italy0.015723
monkey0.015723
male0.012579
arm0.012579
tanzania0.012579
madagascar0.012579
antananarivo0.012579
new delhi0.012579
age 60-790.012579
age 50-60 years0.012579
nanning city prefecture0.012579
guangzhou city prefecture0.012579
oslo0.012579
metabolic syndrome0.012579
LOWER IN city0.012579
age 30-500.012579
mus musculus0.012579
mouse0.012579
tonsil0.012579
LOWER IN duodenum0.012579
rumen0.012579
wastewater treatment plant0.012579
medellin metropolitan area0.009434
daycare0.009434
age 1-5 years0.009434
ileum0.009434
hmong0.009434
LOWER IN female0.009434
forearm0.009434
hadza0.009434
tibetan plateau0.009434
central african republic0.009434
bangui0.009434
state of arizona0.009434
egypt0.009434
Exp. ID User ID Description Date Region Flag Sequences
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare age 1-5 years )2019-02-12v4No1 / 6
406amnonhighfreq feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 8
256amnonhighfreq sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 10
371amnonhighfreq feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 11
131amnonpositively correlated with waist circumference ( high in waist circumference large waist circumference compared to small waist circumference in homo sapiens feces south korea )2017-04-16v4No1 / 12
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 13
400amnonhigh freq. in hmong (chinese) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
517amnonhighfreq forearm, arm, skin, chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens2019-05-29v4No1 / 13
190amnonhighfreq homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 14
393amnonhighfreq homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
438amnonhighfreq feces, homo sapiens, china, age >94, adult, jiangsu province2018-12-30v4No1 / 14
477amnonhighfreq homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
51amnonhighfreq feces, homo sapiens, united states of america2017-01-19v4No1 / 15
75amnonhighfreq homo sapiens, feces, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 15
380amnonhighfreq tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 15
409amnonhighfreq homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
425amnonhighfreq homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 15
425amnonhighfreq homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 15
502amnonhighfreq homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 15
517amnonhighfreq chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 15
51amnonhighfreq homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 16
352amnonhighfreq homo sapiens, feces, india, new delhi2018-07-30v4No1 / 16
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
399amnonhighfreq pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 16
289amnonhighfreq homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 17
290amnonhighfreq homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 17
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
428amnonhighfreq homo sapiens, adult, feces, china, nanchang city prefecture, pancreatitis, acute pancreatitis2018-12-09v4No1 / 17
36amnonhighfreq homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (highfreq homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
215amnonhighfreq homo sapiens, feces, united states of america2017-10-23v4No1 / 18
294amnonhighfreq homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (highfreq homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 18
339amnonhighfreq homo sapiens, feces, india, adult2018-05-24v4No1 / 18
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
428amnonhighfreq homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 18
430amnonhighfreq homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 18
477amnonhighfreq homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 18
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
160amnonhigh freq. in river water upstream of WTP effluent in autumn in china (highfreq river, china, water, autumn)2017-07-12v4No1 / 19
256amnonhighfreq sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 19
276amnonhighfreq feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 19
292amnonhighfreq homo sapiens, china, adult, feces, control2018-02-05v4No1 / 19
401amnonhighfreq homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 19
404amnonhighfreq homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
438amnonhighfreq homo sapiens, feces, china, age 19-242018-12-30v4No1 / 19
438amnonhighfreq feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 19
449amnonhighfreq homo sapiens, feces, colombia2019-01-09v4No1 / 19
455amnonhighfreq homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhighfreq homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 19
477amnonhighfreq homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 19
482amnonhighfreq homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (highfreq homo sapiens, feces, india, infant)2016-12-19v4No1 / 20
238amnonhighfreq homo sapiens, feces, colombia2017-11-07v4No1 / 20
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (highfreq homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 20
333amnonhigh freq. in healthy controls feces (highfreq homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 20
344amnonhigh freq. in feces of homosexual males (highfreq homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 20
390amnonhighfreq homo sapiens, feces, diarrhea, australia, hospital2018-11-04v4No1 / 20
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
409amnonhighfreq homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
477amnonhighfreq homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 20
484amnonhighfreq feces, adult, age 17-29, united states of america, state of michigan, homo sapiens2019-02-13v4No1 / 20
72amnonhighfreq canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 21
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
240amnonhigh freq. in infants age <3 years (highfreq homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (highfreq homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 21
249amnonhighfreq homo sapiens, feces, united states of america2017-11-22v4No1 / 21
320amnonhighfreq homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 21
393amnonhighfreq homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 21
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 21
409amnonhighfreq homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
69amnonhighfreq canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 22
120amnonhighfreq homo sapiens, feces, brazil2017-04-12v4No1 / 22
284amnonhighfreq homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (highfreq homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 22
333amnonhigh freq. in stroke patient feces (highfreq homo sapiens, feces, china, guangzhou city prefecture, adult, stroke)2018-05-15v4No1 / 22
425amnonhighfreq homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
467amnonhighfreq homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
502amnonhighfreq homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 22
10amnonhighfreq homo sapiens, feces, toronto2016-10-27v4No1 / 23
53amnonhighfreq homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 23
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (highfreq homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (highfreq homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 23
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 23
312amnonhighfreq feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 23
314amnonhighfreq caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-10v4No1 / 23
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
487amnonhighfreq homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 23
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
371amnonhigher in saliva of amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in homo sapiens saliva )2018-09-06v4No1 / 24
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v4No1 / 25
53amnonhighfreq lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
284amnoncommon homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 25
290amnonhighfreq homo sapiens, feces, china, adult, city2018-02-01v4No1 / 25
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, pancreatitis, acute pancreatitis2018-12-09v4No1 / 25
436amnonhighfreq felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 25
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
438amnonhighfreq feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 26
131amnonhighfreq homo sapiens, feces, south korea2017-04-16v4No1 / 27
488amnonhighfreq canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 27
540amnonhighfreq state of arizona, flagstaff, united states of america, feces, canis lupus familiaris, dog2019-07-31v4No1 / 27
319amnonhighfreq homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 28
365amnonhighfreq homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
540amnoncommon state of arizona, flagstaff, united states of america, feces, canis lupus familiaris, dog2019-07-31v4No1 / 28
231amnonhigh freq. in dog rectum (highfreq dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 29
438amnonhighfreq homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 29
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
438amnonhighfreq homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 30
436amnonlower in cats with chronic kidney disease compared to healthy controls ( high in control compared to chronic kidney disease in felis catus cat feces united states of america state of colorado )2018-12-25v4No1 / 31
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
131amnon high in male compared to female in homo sapiens feces south korea 2017-04-16v4No1 / 34
509amnon high in urinary schistosomiasis schistosomiasis compared to control in feces homo sapiens nigeria kebbi state rural community child age 10-15 years 2019-03-18v4No1 / 34
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
51amnon high in hiv infection compared to control in homo sapiens feces united states of america 2017-01-19v4No1 / 39
352amnoncommon homo sapiens, feces, india, new delhi2018-07-30v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
231amnoncommon in dog genitalia (common dog, canis lupus familiaris, united states of america, reproductive system, reproductive organ, genitalia)2017-11-02v4No1 / 43
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
292amnoncommon homo sapiens, china, adult, feces, ulcerative colitis2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, china, stroke, adult, guangzhou city prefecture)2018-05-15v4No1 / 53
292amnoncommon homo sapiens, china, adult, feces, crohn's disease2018-02-05v4No1 / 55
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in canis lupus familiaris dog feces italy )2019-02-25v4No1 / 56
488amnoncommon canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 56
260amnoncommon homo sapiens, dentition, subgingival plaque, mouth, united states of america, state of nebraska2017-12-05v4No1 / 59
333amnoncommon in healthy controls feces (common homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
301amnoncommon canis lupus familiaris, dog, united states of america, ileum2018-03-05v4No1 / 69
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 77
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 77
301amnon high in colon rectum compared to duodenum ileum in canis lupus familiaris dog united states of america 2018-03-05v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, india, adult2018-05-24v4No1 / 81
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 84
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours compared to age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig united kingdom caecum )2017-11-26v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
301amnoncommon canis lupus familiaris, dog, united states of america, colon2018-03-05v4No1 / 105
491amnoncommon ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
301amnoncommon canis lupus familiaris, dog, united states of america, rectum2018-03-05v4No1 / 116
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
517amnoncommon forearm, arm, skin, chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens2019-05-29v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 126
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content china tibet autonomous region farm 2018-04-10v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
179amnoncommon mus musculus, mouse, oral cavity, mouth, research facility, united states of america, balb/c2017-08-13v4No1 / 183
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
402amnon high in zone 1 compared to zone 2,3 in china sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region 2018-11-18v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens india new delhi 2018-07-30v4No1 / 190
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
438amnonlower in centenarians compared to adults ( high in age 30-50 age 60-79 compared to age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
433amnoncommon sea water, ocean, depth 4m, south china sea, coast2018-12-19v4No1 / 215
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
485amnoncommon water, ocean water, saline water, mediterranean sea, italy, gulf of naples, surface water, depth 0-1 meter, coast2019-02-19v4No1 / 244
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, south korea, female)2017-10-24v4No1 / 250
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, china, water, spring)2017-07-12v4No1 / 278
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, fresh water, salinity <5 ppt2019-03-20v4No1 / 317
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 328
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in china soil heavy metal )2017-07-29v4No1 / 337
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
254amnoncommon river, china, water, fresh water, depth 0.5m, jiulong river, fujian province2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river china water fresh water depth 0.5m jiulong river fujian province )2017-11-23v4No1 / 356
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, china, water, autumn)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
424amnoncommon sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
80amnon high in tropical moist broadleaf forest biome compared to dry forest in feces alouatta pigra howler monkey woodland central america 2017-03-03v4No1 / 465
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
329amnoncommon ovis aries, sheep, kingdom of norway, rumen2018-05-13v4No1 / 506
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common china, wastewater treatment plant, effluent, spring)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to fall winter dry season in river china water fresh water depth 0.5m jiulong river fujian province 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
507amnon high in sediment depth 8-10cm compared to sediment depth 0-5cm in lake sediment sediment canada quesnel lake province of british columbia 2019-03-17v4No1 / 765
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023

Problems / suggestions? Please email info AT dbbact DOT org