Search result for sequence:
TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.500960
feces0.449770
adult0.305310
child0.242075
rural community0.216366
china0.181818
united states of america0.160961
city0.135304
india0.121212
obsolete_juvenile stage0.109091
control0.105660
colombia0.098324
hunter gatherer0.097923
zoological garden0.096350
sus scrofa0.095735
pig0.095735
africa0.086957
amerindian0.080537
venezuela0.080537
himalayas0.078947
nepal0.075949
small village0.072508
LOWER IN united states of america0.071813
caecum0.069971
female0.067265
chuquisaca department0.062500
age 5-13 years0.062500
bolivia0.058824
msm0.054795
gay0.054795
homosexual0.054795
tibet autonomous region0.054795
nigeria0.054795
monkey0.054054
duodenum0.053097
state of colorado0.051948
jiangsu province0.051282
state of tennessee0.050000
skin0.046512
thailand0.045455
new delhi0.045455
nanchang city prefecture0.045455
farm0.040541
united kingdom0.039216
arm0.037037
biopsy0.036923
mouse0.036866
research facility0.036765
central african republic0.036697
bangui0.036697
madagascar0.036697
antananarivo0.036697
age 50-60 years0.036697
nanning city prefecture0.036697
kebbi state0.036697
age 10-15 years0.036697
south korea0.036697
right colon0.036364
ileum0.036254
LOWER IN city0.036036
rectum0.036036
mus musculus0.035714
water0.035088
colon0.034188
fresh water0.032787
infant0.032520
state of california0.032258
macaca mulatta0.027972
daycare0.027778
age 1-5 years0.027778
hmong0.027778
forearm0.027778
biopsy site0.027778
tunapuco0.027778
age 19-240.027778
age 60-790.027778
guangzhou city prefecture0.027778
denver0.027778
stunted growth0.027778
el salvador0.027778
age 130.027778
cecal content0.027778
wastewater treatment plant0.027778
LOWER IN duodenum0.027650
medellin metropolitan area0.027397
egypt0.027397
peru0.027397
kingdom of denmark0.027397
left colon0.027027
juvenile organism0.027027
tibetan plateau0.026667
kingdom of spain0.026667
river0.026316
male0.026201
age0.026201
LOWER IN control0.024465
state of oklahoma0.018779
LOWER IN heterosexual0.018779
LOWER IN msw0.018779
gorilla gorilla0.018779
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community0.857143
colombia0.800000
hunter gatherer0.750000
small village0.750000
amerindian0.666667
venezuela0.666667
arm0.666667
msm0.666667
gay0.666667
homosexual0.666667
tibet autonomous region0.666667
india0.666667
nigeria0.666667
macaca mulatta0.666667
state of oklahoma0.666667
LOWER IN heterosexual0.666667
LOWER IN msw0.666667
gorilla gorilla0.666667
LOWER IN united states of america0.625000
zoological garden0.600000
biopsy0.600000
sus scrofa0.555556
pig0.555556
low hdl0.500000
LOWER IN high hdl0.500000
daycare0.500000
age 1-5 years0.500000
trichuriasis0.500000
przewalski horse0.500000
thailand0.500000
hmong0.500000
forearm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
hadza0.500000
karen0.500000
myanmar0.500000
age >940.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
africa0.500000
central african republic0.500000
bangui0.500000
madagascar0.500000
antananarivo0.500000
biopsy site0.500000
new delhi0.500000
azerbaijan0.500000
pan troglodytes0.500000
chimpanzee0.500000
nanchang city prefecture0.500000
pancreatitis0.500000
acute pancreatitis0.500000
irritable bowel syndrome0.500000
age 200.500000
chepang0.500000
tunapuco0.500000
age 19-240.500000
age 60-790.500000
raute0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
guangzhou city prefecture0.500000
denver0.500000
raji0.500000
macaque0.500000
stroke0.500000
stunted growth0.500000
kebbi state0.500000
age 10-15 years0.500000
el salvador0.500000
age 130.500000
native american0.500000
cheyenne0.500000
arapaho0.500000
LOWER IN american0.500000
cecal content0.500000
schistosomiasis0.500000
urinary schistosomiasis0.500000
LOWER IN age 12-23 years0.500000
age 1-7 years0.500000
monkey0.500000
south korea0.500000
qiaamp dna stool mini kit0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
LOWER IN age 28 days0.500000
LOWER IN premature birth0.500000
hmong 2nd generation0.500000
sudan0.500000
LOWER IN diarrhea0.500000
bangladesh0.500000
jordan0.500000
intestinal contents0.500000
lima0.500000
shantytown0.500000
age 30-500.500000
LOWER IN gangcha region0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.800000
homo sapiens0.790476
adult0.300000
united states of america0.204762
china0.200000
child0.171429
rural community0.123810
control0.095238
city0.080952
india0.066667
obsolete_juvenile stage0.066667
colombia0.052381
zoological garden0.052381
hunter gatherer0.052381
sus scrofa0.052381
pig0.052381
africa0.047619
amerindian0.042857
venezuela0.042857
female0.042857
nepal0.042857
himalayas0.042857
caecum0.042857
small village0.038095
LOWER IN united states of america0.038095
chuquisaca department0.033333
bolivia0.033333
age 5-13 years0.033333
skin0.028571
state of colorado0.028571
msm0.028571
gay0.028571
homosexual0.028571
jiangsu province0.028571
tibet autonomous region0.028571
state of tennessee0.028571
duodenum0.028571
nigeria0.028571
research facility0.028571
monkey0.028571
thailand0.023810
new delhi0.023810
nanchang city prefecture0.023810
united kingdom0.023810
farm0.023810
mus musculus0.023810
mouse0.023810
water0.023810
LOWER IN control0.019048
arm0.019048
central african republic0.019048
bangui0.019048
madagascar0.019048
antananarivo0.019048
biopsy0.019048
right colon0.019048
infant0.019048
age 50-60 years0.019048
nanning city prefecture0.019048
state of california0.019048
kebbi state0.019048
age 10-15 years0.019048
LOWER IN city0.019048
south korea0.019048
colon0.019048
ileum0.019048
rectum0.019048
fresh water0.019048
medellin metropolitan area0.014286
daycare0.014286
age 1-5 years0.014286
hmong0.014286
male0.014286
forearm0.014286
tibetan plateau0.014286
biopsy site0.014286
kingdom of spain0.014286
egypt0.014286
left colon0.014286
peru0.014286
tunapuco0.014286
age 19-240.014286
age 60-790.014286
guangzhou city prefecture0.014286
denver0.014286
macaca mulatta0.014286
stunted growth0.014286
kingdom of denmark0.014286
el salvador0.014286
age 130.014286
juvenile organism0.014286
cecal content0.014286
age0.014286
LOWER IN duodenum0.014286
river0.014286
wastewater treatment plant0.014286
equus przewalskii0.009524
przewalski horse0.009524
LOWER IN female0.009524
tanzania0.009524
Exp. ID User ID Description Date Region Flag Sequences
404amnonnegatively correlated with hdl levels ( high in low hdl compared to high hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 4
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare age 1-5 years )2019-02-12v4No1 / 6
406amnonhighfreq feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 8
371amnonhighfreq feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 11
400amnonhigh freq. in hmong (chinese) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
517amnonhighfreq forearm, arm, skin, chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens2019-05-29v4No1 / 13
190amnonhighfreq homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 14
393amnonhighfreq homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (highfreq homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
438amnonhighfreq feces, homo sapiens, china, age >94, adult, jiangsu province2018-12-30v4No1 / 14
477amnonhighfreq homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
51amnonhighfreq feces, homo sapiens, united states of america2017-01-19v4No1 / 15
74amnonhighfreq united states of america, feces, homo sapiens2017-02-27v4No1 / 15
75amnonhighfreq homo sapiens, feces, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 15
380amnonhighfreq tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 15
425amnonhighfreq homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 15
425amnonhighfreq homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 15
517amnonhighfreq chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 15
51amnonhighfreq homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 16
352amnonhighfreq homo sapiens, feces, india, new delhi2018-07-30v4No1 / 16
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
399amnonhighfreq pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 16
290amnonhighfreq homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 17
352amnonhigh freq. in duodenal biopsies (highfreq homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 17
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
428amnonhighfreq homo sapiens, adult, feces, china, nanchang city prefecture, pancreatitis, acute pancreatitis2018-12-09v4No1 / 17
36amnonhighfreq homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
294amnonhighfreq homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
339amnonhighfreq homo sapiens, feces, india, adult2018-05-24v4No1 / 18
428amnonhighfreq homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 18
430amnonhighfreq homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 18
477amnonhighfreq homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 18
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
256amnonhighfreq sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 19
276amnonhighfreq feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 19
292amnonhighfreq homo sapiens, china, adult, feces, control2018-02-05v4No1 / 19
404amnonhighfreq homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
438amnonhighfreq homo sapiens, feces, china, age 19-242018-12-30v4No1 / 19
438amnonhighfreq feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 19
449amnonhighfreq homo sapiens, feces, colombia2019-01-09v4No1 / 19
477amnonhighfreq homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 19
482amnonhighfreq homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 19
45amnonhigh freq. in feces babies <2 years in india (highfreq homo sapiens, feces, india, infant)2016-12-19v4No1 / 20
238amnonhighfreq homo sapiens, feces, colombia2017-11-07v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (highfreq homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 20
333amnonhigh freq. in healthy controls feces (highfreq homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 20
344amnonhigh freq. in feces of homosexual males (highfreq homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 20
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
409amnonhighfreq homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
477amnonhighfreq homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 20
398amnonhigh freq. in feces of healthy adults from belgium (highfreq homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 21
120amnonhighfreq homo sapiens, feces, brazil2017-04-12v4No1 / 22
284amnonhighfreq homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (highfreq homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 22
333amnonhigh freq. in stroke patient feces (highfreq homo sapiens, feces, china, guangzhou city prefecture, adult, stroke)2018-05-15v4No1 / 22
425amnonhighfreq homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
467amnonhighfreq homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
502amnonhighfreq homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 22
53amnonhighfreq homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 23
197amnonhighfreq feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 23
242amnonhigher in native-americans compared to non native-american ( high in native american cheyenne arapaho compared to american in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 23
314amnonhighfreq caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-10v4No1 / 23
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
509amnonhighfreq feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 23
542amnon high in age 1-7 years child compared to age 12-23 years adult in puerto rico research facility macaca mulatta monkey dentition subgingival plaque 2019-08-01v4No1 / 23
371amnonhigher in saliva of amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in homo sapiens saliva )2018-09-06v4No1 / 24
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, pancreatitis, acute pancreatitis2018-12-09v4No1 / 25
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
131amnonhighfreq homo sapiens, feces, south korea2017-04-16v4No1 / 27
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, india, infant)2016-12-19v4No1 / 31
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
51amnon high in hiv infection compared to control in homo sapiens feces united states of america 2017-01-19v4No1 / 39
352amnoncommon homo sapiens, feces, india, new delhi2018-07-30v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
333amnoncommon in healthy controls feces (common homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, india, adult2018-05-24v4No1 / 81
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig united kingdom caecum )2017-11-26v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
517amnoncommon chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens, feces2019-05-29v4No1 / 113
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
517amnoncommon forearm, arm, skin, chuquisaca department, rural community, bolivia, age 5-13 years, child, homo sapiens2019-05-29v4No1 / 121
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content china tibet autonomous region farm 2018-04-10v4No1 / 136
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, schistosomiasis, urinary schistosomiasis2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, nigeria, kebbi state, rural community, child, age 10-15 years, control2019-03-18v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
179amnoncommon mus musculus, mouse, oral cavity, mouth, research facility, united states of america, balb/c2017-08-13v4No1 / 183
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
402amnon high in zone 1 compared to zone 2,3 in china sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region 2018-11-18v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens india new delhi 2018-07-30v4No1 / 190
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 191
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, south korea, female)2017-10-24v4No1 / 250
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 297
331amnoncommon feces, monkey, theropithecus gelada, ethiopia2018-05-13v4No1 / 298
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, fresh water, salinity <5 ppt2019-03-20v4No1 / 317
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
111amnoncommon mongolian sheep, china, ovis aries, rectum, ileum, cecum, colon2017-04-09v4No1 / 330
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in age 2-4 weeks preweaned suckling compared to age 4-7 weeks corn and soybean diet weaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river china water fresh water depth 0.5m jiulong river fujian province )2017-11-23v4No1 / 356
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth 25cm in north america )2017-10-15v4No1 / 359
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, china, water, autumn)2017-07-12v4No1 / 376
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 378
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
424amnoncommon sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-06v4No1 / 452
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep china ovis aries 2017-04-09v4No1 / 464
80amnon high in tropical moist broadleaf forest biome compared to dry forest in feces alouatta pigra howler monkey woodland central america 2017-03-03v4No1 / 465
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
160amnoncommon in wastewater treatment plant effluent in spring in china (common china, wastewater treatment plant, effluent, spring)2017-07-12v4No1 / 573
254amnon high in summer wet season compared to fall winter dry season in river china water fresh water depth 0.5m jiulong river fujian province 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 606
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 818
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org