Search result for sequence:
TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCGTTTAAGCGTGTTGTGAAATGTAGGCGCCCAACGTCTGCACTGCAGCGCGAACTGGATGACTTGAGTACGCGGGAAGCAGGCGGAATTCGTCG
common ontology terms
term enrichment score
TermScore
rumen0.685714
ovis aries0.448598
ruminant reticulum0.408163
omasum0.408163
mongolian sheep0.370370
bos taurus0.242424
zoological garden0.222222
cecum0.190476
bos grunniens0.190476
age 30 days0.190476
dairy0.190476
state of nebraska0.173913
LOWER IN rectum0.166667
captive0.160000
LOWER IN caecum0.137931
LOWER IN colon0.129032
cow0.121212
ileum0.114286
rectum0.108108
obsolete_juvenile stage0.108108
loxodonta africana0.105263
african elephant0.105263
san diego zoo0.105263
LOWER IN ceratotherium simum simum0.105263
holstein-friesian bull0.105263
italy0.102564
yak0.100000
black rhinoceros0.100000
diceros bicornis0.100000
LOWER IN ceratotherium simum0.100000
LOWER IN white rhinoceros0.100000
rhinoceros unicornis0.100000
greater one-horned rhinoceros0.100000
ireland0.095238
state of tennessee0.090909
sheep0.090909
kingdom of norway0.080000
LOWER IN ileum0.076923
sweden0.074074
colon0.072727
china0.052963
farm0.044444
united states of america0.037453
female0.035714
feces0.016327
Fraction of dbbact annotations with this term covered by the query
TermScore
rumen0.666667
ruminant reticulum0.666667
omasum0.666667
mongolian sheep0.500000
cecum0.500000
bos grunniens0.500000
loxodonta africana0.500000
african elephant0.500000
age 30 days0.500000
dairy0.500000
san diego zoo0.500000
LOWER IN ceratotherium simum simum0.500000
holstein-friesian bull0.500000
ovis aries0.428571
state of nebraska0.333333
yak0.333333
black rhinoceros0.333333
diceros bicornis0.333333
LOWER IN ceratotherium simum0.333333
LOWER IN white rhinoceros0.333333
rhinoceros unicornis0.333333
greater one-horned rhinoceros0.333333
zoological garden0.300000
LOWER IN rectum0.285714
bos taurus0.250000
captive0.250000
ireland0.250000
state of tennessee0.200000
sheep0.200000
LOWER IN caecum0.166667
LOWER IN colon0.142857
cow0.125000
kingdom of norway0.125000
ileum0.111111
LOWER IN ileum0.111111
rectum0.100000
obsolete_juvenile stage0.100000
sweden0.100000
italy0.090909
colon0.052632
farm0.035714
china0.028302
female0.025641
united states of america0.020000
feces0.008772
Fraction of annotations for the query sequences containing the term
TermScore
rumen0.705882
ovis aries0.470588
china0.411765
mongolian sheep0.294118
ruminant reticulum0.294118
omasum0.294118
united states of america0.294118
bos taurus0.235294
zoological garden0.176471
rectum0.117647
ileum0.117647
cecum0.117647
colon0.117647
cow0.117647
state of nebraska0.117647
bos grunniens0.117647
feces0.117647
LOWER IN rectum0.117647
LOWER IN caecum0.117647
LOWER IN colon0.117647
age 30 days0.117647
obsolete_juvenile stage0.117647
italy0.117647
dairy0.117647
captive0.117647
yak0.058824
farm0.058824
loxodonta africana0.058824
african elephant0.058824
state of tennessee0.058824
LOWER IN ileum0.058824
black rhinoceros0.058824
diceros bicornis0.058824
sheep0.058824
kingdom of norway0.058824
san diego zoo0.058824
female0.058824
LOWER IN ceratotherium simum0.058824
LOWER IN ceratotherium simum simum0.058824
LOWER IN white rhinoceros0.058824
rhinoceros unicornis0.058824
greater one-horned rhinoceros0.058824
holstein-friesian bull0.058824
ireland0.058824
sweden0.058824
Exp. ID User ID Description Date Region Flag Sequences
111amnondominant mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 13
111amnondominant rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 18
261amnondominant bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 19
439amnoncommon bos grunniens, yak, rumen, farm, china2018-12-31v4No1 / 52
399amnoncommon feces, united states of america, loxodonta africana, african elephant, zoological garden, state of tennessee2018-11-16v4No1 / 252
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 253
261amnoncommon bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 266
111amnon high in rumen ruminant reticulum omasum compared to rectum ileum caecum colon in mongolian sheep ovis aries china 2017-04-09v4No1 / 294
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
363amnon high in rumen ruminant reticulum omasum compared to caecum colon rectum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 360
559amnoncommon feces, united states of america, black rhinoceros, diceros bicornis, captive, zoological garden2019-11-03v4No1 / 382
329amnoncommon ovis aries, sheep, kingdom of norway, rumen2018-05-13v4No1 / 506
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
560amnon high in rhinoceros unicornis greater one-horned rhinoceros compared to ceratotherium simum ceratotherium simum simum white rhinoceros in zoological garden captive united states of america san diego zoo female 2019-11-04v4No1 / 656
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
82amnoncommon in dairy cow rumen fluid (common bos taurus, sweden, rumen)2017-03-05v4No1 / 1322

Problems / suggestions? Please email info AT dbbact DOT org