Search result for sequence:
TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCGTTTAAGCGTGTTGTGAAATGTAGGCGCCCAACGTCTGCACTGCAGCGCGAACTGGATGACTTGAGTACGCGGGAAGCAGGCGGAATTCGTCG
common ontology terms
term enrichment score
TermScore
rumen0.685714
ovis aries0.484848
ruminant reticulum0.408163
omasum0.408163
mongolian sheep0.370370
bos taurus0.252632
zoological garden0.240000
cecum0.190476
bos grunniens0.190476
age 30 days0.190476
dairy0.190476
state of nebraska0.173913
LOWER IN rectum0.173913
captive0.173913
LOWER IN caecum0.148148
cow0.129032
LOWER IN colon0.129032
ileum0.121212
rectum0.114286
obsolete_juvenile stage0.108108
italy0.108108
loxodonta africana0.105263
african elephant0.105263
LOWER IN ceratotherium simum simum0.105263
san diego zoo0.105263
holstein-friesian bull0.105263
yak0.100000
diceros bicornis0.100000
black rhinoceros0.100000
greater one-horned rhinoceros0.100000
rhinoceros unicornis0.100000
LOWER IN white rhinoceros0.100000
LOWER IN ceratotherium simum0.100000
sheep0.095238
ireland0.095238
state of tennessee0.090909
LOWER IN ileum0.080000
kingdom of norway0.080000
sweden0.076923
colon0.072727
china0.061047
farm0.050000
united states of america0.039880
female0.039216
feces0.017699
Fraction of dbbact annotations with this term covered by the query
TermScore
rumen0.666667
ruminant reticulum0.666667
omasum0.666667
mongolian sheep0.500000
ovis aries0.500000
cecum0.500000
bos grunniens0.500000
loxodonta africana0.500000
african elephant0.500000
age 30 days0.500000
dairy0.500000
LOWER IN ceratotherium simum simum0.500000
san diego zoo0.500000
holstein-friesian bull0.500000
zoological garden0.375000
state of nebraska0.333333
yak0.333333
LOWER IN rectum0.333333
captive0.333333
diceros bicornis0.333333
black rhinoceros0.333333
greater one-horned rhinoceros0.333333
rhinoceros unicornis0.333333
LOWER IN white rhinoceros0.333333
LOWER IN ceratotherium simum0.333333
bos taurus0.272727
sheep0.250000
ireland0.250000
state of tennessee0.200000
LOWER IN caecum0.200000
cow0.142857
LOWER IN colon0.142857
ileum0.125000
LOWER IN ileum0.125000
kingdom of norway0.125000
rectum0.111111
sweden0.111111
obsolete_juvenile stage0.100000
italy0.100000
colon0.052632
farm0.043478
china0.032967
female0.029412
united states of america0.021390
feces0.009569
Fraction of annotations for the query sequences containing the term
TermScore
rumen0.705882
ovis aries0.470588
china0.411765
mongolian sheep0.294118
ruminant reticulum0.294118
omasum0.294118
united states of america0.294118
bos taurus0.235294
zoological garden0.176471
rectum0.117647
ileum0.117647
cecum0.117647
colon0.117647
cow0.117647
state of nebraska0.117647
bos grunniens0.117647
feces0.117647
LOWER IN rectum0.117647
LOWER IN caecum0.117647
LOWER IN colon0.117647
age 30 days0.117647
obsolete_juvenile stage0.117647
italy0.117647
dairy0.117647
captive0.117647
yak0.058824
farm0.058824
loxodonta africana0.058824
african elephant0.058824
state of tennessee0.058824
LOWER IN ileum0.058824
diceros bicornis0.058824
black rhinoceros0.058824
sheep0.058824
kingdom of norway0.058824
greater one-horned rhinoceros0.058824
rhinoceros unicornis0.058824
LOWER IN white rhinoceros0.058824
LOWER IN ceratotherium simum simum0.058824
LOWER IN ceratotherium simum0.058824
female0.058824
san diego zoo0.058824
holstein-friesian bull0.058824
ireland0.058824
sweden0.058824
Exp. ID User ID Description Date Region Flag Sequences
111amnonhighfreq mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 13
111amnonhighfreq rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 18
261amnonhighfreq bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 19
439amnoncommon bos grunniens, yak, rumen, farm, china2018-12-31v4No1 / 52
399amnoncommon feces, united states of america, loxodonta africana, african elephant, zoological garden, state of tennessee2018-11-16v4No1 / 252
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 253
261amnoncommon bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 266
111amnon high in rumen ruminant reticulum omasum compared to rectum ileum caecum colon in mongolian sheep ovis aries china 2017-04-09v4No1 / 294
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
363amnon high in rumen ruminant reticulum omasum compared to caecum colon rectum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 360
559amnoncommon zoological garden, captive, diceros bicornis, black rhinoceros, united states of america, feces2019-11-03v4No1 / 382
329amnoncommon ovis aries, sheep, kingdom of norway, rumen2018-05-13v4No1 / 506
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
560amnon high in greater one-horned rhinoceros rhinoceros unicornis compared to white rhinoceros ceratotherium simum simum ceratotherium simum in female san diego zoo united states of america captive zoological garden 2019-11-04v4No1 / 656
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
82amnoncommon in dairy cow rumen fluid (common bos taurus, sweden, rumen)2017-03-05v4No1 / 1322

Problems / suggestions? Please email info AT dbbact DOT org