Search result for sequence:
TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGTATTTTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGAATTGCAGCGCGAACTGGAGTACTTGAGTGCGCAGGAAGTTGGCGGAATTCGTCG
common ontology terms
term enrichment score
TermScore
horse0.461538
equus caballus0.413793
caecum0.333333
state of texas0.333333
LOWER IN equine grass sickness0.333333
LOWER IN equus caballus0.333333
cecal content0.285714
LOWER IN disease0.250000
equus przewalskii0.250000
united kingdom0.153846
LOWER IN feces0.100000
farm0.062500
adult0.020000
research facility0.018182
feces0.017241
control0.013793
united states of america0.009901
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN equine grass sickness0.500000
LOWER IN equus caballus0.500000
horse0.333333
equus caballus0.285714
caecum0.250000
state of texas0.250000
LOWER IN disease0.250000
equus przewalskii0.250000
cecal content0.200000
united kingdom0.111111
LOWER IN feces0.062500
farm0.035714
adult0.010204
research facility0.009259
feces0.008772
control0.007092
united states of america0.005000
Fraction of annotations for the query sequences containing the term
TermScore
horse0.750000
equus caballus0.750000
caecum0.500000
cecal content0.500000
adult0.500000
united states of america0.500000
state of texas0.500000
research facility0.500000
feces0.500000
LOWER IN feces0.250000
farm0.250000
control0.250000
LOWER IN equine grass sickness0.250000
LOWER IN disease0.250000
united kingdom0.250000
equus przewalskii0.250000
LOWER IN equus caballus0.250000

Problems / suggestions? Please email info AT dbbact DOT org