Search result for sequence:
TACGGAAGGTCCTGGCGTTATCCGGATTCATTGGGTTTAAAGGGAGCGCAGGCGGCGATGTAAGCGTGCCGTGAAATGCCGTGGCTCAACCATGGCACTGCGGCGCGAACTGCGTTGCTTGAGTGCGCGGAAGGCGGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
belgium0.222222
crohn's disease0.153846
LOWER IN control0.010753
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
belgium0.125000
crohn's disease0.083333
LOWER IN control0.005405
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
crohn's disease1.000000
LOWER IN control1.000000
feces1.000000
homo sapiens1.000000
belgium1.000000
Exp. ID User ID Description Date Region Flag Sequences
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68

Problems / suggestions? Please email info AT dbbact DOT org