Search result for sequence:
TACGGAAGGTCCTGGCGTTATCCGGATTCATTGGGTTTAAAGGGAGCGCAGGCGGCGATGTAAGCGTGCCGTGAAATGCCGTGGCTCAACCATGGCACTGCGGCGCGAACTGCGTTGCTTGAGTGCGCGGAAGGCGGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
belgium0.222222
crohn's disease0.133333
LOWER IN control0.010471
homo sapiens0.006897
feces0.005780
Fraction of dbbact annotations with this term covered by the query
TermScore
belgium0.125000
crohn's disease0.071429
LOWER IN control0.005263
homo sapiens0.003460
feces0.002899
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
feces1.000000
belgium1.000000
LOWER IN control1.000000
crohn's disease1.000000
Exp. ID User ID Description Date Region Flag Sequences
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68

Problems / suggestions? Please email info AT dbbact DOT org