Search result for sequence:
TACGGAAGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGTAGGTGGCTTGGTAAGTCGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCGATACTGCTGAGCTAGAGTACGAAAGAGGGGGGTGGAATTCCAGG
common ontology terms
term enrichment score
TermScore
jiulong river0.666667
fujian province0.666667
depth 0.5m0.500000
LOWER IN autumn0.285714
LOWER IN dry season0.266667
wet season0.266667
autumn0.181818
river0.153846
LOWER IN winter0.137931
summer0.114286
fresh water0.105263
water0.042553
china0.023256
Fraction of dbbact annotations with this term covered by the query
TermScore
jiulong river0.500000
fujian province0.500000
depth 0.5m0.333333
LOWER IN autumn0.250000
LOWER IN dry season0.166667
wet season0.166667
autumn0.125000
river0.083333
LOWER IN winter0.076923
summer0.062500
fresh water0.055556
water0.021739
china0.011765
Fraction of annotations for the query sequences containing the term
TermScore
river1.000000
water1.000000
fresh water1.000000
depth 0.5m1.000000
jiulong river1.000000
fujian province1.000000
china1.000000
summer0.666667
LOWER IN winter0.666667
LOWER IN dry season0.666667
wet season0.666667
autumn0.333333
LOWER IN autumn0.333333

Problems / suggestions? Please email info AT dbbact DOT org