Search result for sequence:
TACGGAAGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGTAGGTGGCTTGGTAAGTCGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCGATACTGCTGAGCTAGAGTACGAAAGAGGGGGGTGGAATTCCAGG
common ontology terms
term enrichment score
TermScore
jiulong river0.666667
fujian province0.666667
depth 0.5m0.500000
LOWER IN dry season0.266667
wet season0.266667
LOWER IN autumn0.250000
river0.153846
autumn0.153846
LOWER IN winter0.129032
summer0.102564
fresh water0.100000
water0.039216
china0.018868
Fraction of dbbact annotations with this term covered by the query
TermScore
jiulong river0.500000
fujian province0.500000
depth 0.5m0.333333
LOWER IN autumn0.200000
LOWER IN dry season0.166667
wet season0.166667
autumn0.100000
river0.083333
LOWER IN winter0.071429
summer0.055556
fresh water0.052632
water0.020000
china0.009524
Fraction of annotations for the query sequences containing the term
TermScore
river1.000000
water1.000000
fresh water1.000000
depth 0.5m1.000000
jiulong river1.000000
fujian province1.000000
china1.000000
summer0.666667
LOWER IN winter0.666667
LOWER IN dry season0.666667
wet season0.666667
autumn0.333333
LOWER IN autumn0.333333

Problems / suggestions? Please email info AT dbbact DOT org