Search result for sequence:
TACGGAGACTGCAAGCGTTACTCGGATTTACTGGGCGTAAAGGGTCCGTAGGCGGCCGTGTGTGTCGGGTGTGAAATCCTGCAGCTTAACTGTAGAATTGCGCCCGAAACTACACGGCTAGAGTATTGGAGAGGTGAGTGGAATTCCTGG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
bobtail squid0.500000
euprymna scolopes0.500000
egg jelly0.500000
LOWER IN shell gland0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
kandelia candel0.500000
leizhou nature reserve0.500000
hainan autonomous prefecture0.333333
mangrove0.333333
guangdong province0.333333
spartina alterniflora0.333333
hawaii0.250000
mangrove swamp0.250000
shelled egg0.200000
zhejiang province0.166667
depth 0-20cm0.142857
marine sediment0.071429
soil0.015873
china0.009434
Fraction of annotations for the query sequences containing the term
TermScore
china0.833333
soil0.833333
mangrove swamp0.833333
marine sediment0.833333
depth 0-20cm0.833333
mangrove0.500000
hainan autonomous prefecture0.333333
kandelia candel0.333333
guangdong province0.333333
leizhou nature reserve0.333333
hawaii0.166667
bobtail squid0.166667
euprymna scolopes0.166667
egg jelly0.166667
LOWER IN shell gland0.166667
shelled egg0.166667
danzhou xinyinggang nature reserve0.166667
rhizophora stylosa0.166667
dongzhaigang national nature reserve0.166667
mudflat0.166667
zhejiang province0.166667
futian national nature reserve0.166667
spartina alterniflora0.166667

Problems / suggestions? Please email info AT dbbact DOT org