Search result for sequence:
TACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAGTAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAACTACTTTTAAAACTGCTAACCTAGAGATTGAAAGAGGATAGAGGAATTCCTAG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
nida basin0.500000
herbivorous beetle0.500000
crioceris quatuordecimpunctata0.500000
cheilotoma musciformis0.500000
carnivorous beetle0.500000
raba river0.500000
paederus limnophilus0.500000
argoptochus quadrisignatus0.500000
paederidus rubrothoracicus0.500000
aphodius depressus0.500000
detritivorous beetle0.500000
bulgaria0.500000
balkan mountains0.500000
aphodius sphacelatus0.500000
bembidion modestum0.500000
aphodius haemorrhoidalis0.500000
crioceris duodecimpunctata0.500000
onthophagus ruficapillus0.500000
bembidion decorum0.500000
bembidion punctulatum0.500000
onthophagus ovatus0.500000
aphodius pusillus0.500000
carabidae0.500000
LOWER IN staphylinidae0.500000
poland0.333333
beetle0.333333
whole body0.250000
plant0.125000
river0.083333
feces0.004785
Fraction of annotations for the query sequences containing the term
TermScore
whole body1.000000
beetle1.000000
poland0.647059
carnivorous beetle0.352941
river0.352941
detritivorous beetle0.352941
feces0.352941
bulgaria0.352941
balkan mountains0.352941
plant0.294118
nida basin0.294118
herbivorous beetle0.294118
raba river0.294118
crioceris quatuordecimpunctata0.117647
cheilotoma musciformis0.058824
paederus limnophilus0.058824
argoptochus quadrisignatus0.058824
paederidus rubrothoracicus0.058824
aphodius depressus0.058824
aphodius sphacelatus0.058824
bembidion modestum0.058824
aphodius haemorrhoidalis0.058824
crioceris duodecimpunctata0.058824
onthophagus ruficapillus0.058824
bembidion decorum0.058824
bembidion punctulatum0.058824
onthophagus ovatus0.058824
aphodius pusillus0.058824
carabidae0.058824
LOWER IN staphylinidae0.058824
Exp. ID User ID Description Date Region Flag Sequences
515amnonhighfreq poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 3
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, cheilotoma musciformis2019-04-18v4No1 / 11
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 15
515amnoncommon poland, whole body, beetle, carnivorous beetle, river, raba river, paederus limnophilus2019-04-18v4No1 / 16
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
515amnoncommon poland, whole body, beetle, paederidus rubrothoracicus, carnivorous beetle, river, raba river2019-04-18v4No1 / 25
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v4No1 / 127
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion modestum2019-04-18v4No1 / 131
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 178
515amnoncommon bembidion decorum, carnivorous beetle, river, poland, raba river, whole body, beetle2019-04-18v4No1 / 198
515amnoncommon carnivorous beetle, river, poland, raba river, whole body, beetle, bembidion punctulatum2019-04-18v4No1 / 305
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ovatus2019-04-18v4No1 / 322
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v4No1 / 421
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130

Problems / suggestions? Please email info AT dbbact DOT org