Search result for sequence:
TACGGAGGATACGAGCGTTATCCGGAATTATTGGGTTTAAAGGGTGCGTAGGTGGCGTATTAAGTCAGTGGTGAAAAGCTGCAGCTCAACTGTAGTCTTGCCGTTGAAACTGATGTGCTAGAGAGGAGACGAGGTATGCGGAATGTGTGG
common ontology terms
term enrichment score
TermScore
cold environment0.666667
gastrointestinal system mucosa0.571429
12c0.571429
LOWER IN warm temperature habitat0.571429
rainbow trout0.400000
oncorhynchus mykiss0.400000
LOWER IN 18c0.400000
gut content0.400000
temp 12c0.400000
LOWER IN temp 18c0.400000
sweden0.200000
fish0.166667
digestive system0.071429
research facility0.020408
Fraction of dbbact annotations with this term covered by the query
TermScore
gastrointestinal system mucosa0.500000
12c0.500000
cold environment0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN 18c0.500000
gut content0.500000
temp 12c0.500000
LOWER IN temp 18c0.500000
rainbow trout0.250000
oncorhynchus mykiss0.250000
sweden0.111111
fish0.090909
digestive system0.037037
research facility0.010309
Fraction of annotations for the query sequences containing the term
TermScore
sweden1.000000
fish1.000000
rainbow trout1.000000
oncorhynchus mykiss1.000000
research facility1.000000
digestive system1.000000
cold environment1.000000
gastrointestinal system mucosa0.666667
12c0.666667
LOWER IN warm temperature habitat0.666667
LOWER IN 18c0.333333
gut content0.333333
temp 12c0.333333
LOWER IN temp 18c0.333333

Problems / suggestions? Please email info AT dbbact DOT org