Search result for sequence:
TACGGAGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGACGCGCAAGTCAGTGGTGAAATCTCCCGGCTCAACCGGGACCGTGCCTCTGATACTGCGCGACTGGAGAATGAGTGGCGTGGCCGGAATGTGACG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
saint louis zoo0.500000
saint louis0.500000
lincoln park zoo0.500000
age 30 days0.500000
dairy0.500000
LOWER IN caecum0.500000
LOWER IN colon0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
LOWER IN pan troglodytes troglodytes0.500000
gorilla gorilla gorilla0.500000
gorilla gorilla0.400000
chicago0.333333
ruminant reticulum0.333333
omasum0.333333
pan troglodytes0.250000
chimpanzee0.250000
state of tennessee0.200000
zoological garden0.181818
LOWER IN rectum0.142857
ovis aries0.100000
obsolete_juvenile stage0.100000
LOWER IN wild0.100000
italy0.076923
rumen0.076923
united states of america0.009479
feces0.008097
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.818182
zoological garden0.818182
feces0.818182
gorilla gorilla0.454545
lincoln park zoo0.363636
chicago0.363636
pan troglodytes0.272727
chimpanzee0.272727
saint louis zoo0.181818
saint louis0.181818
ovis aries0.181818
age 30 days0.181818
obsolete_juvenile stage0.181818
italy0.181818
dairy0.181818
rumen0.181818
ruminant reticulum0.181818
omasum0.181818
LOWER IN nouabale-ndoki national park0.181818
LOWER IN republic of congo0.181818
LOWER IN wild0.181818
LOWER IN caecum0.090909
LOWER IN colon0.090909
LOWER IN rectum0.090909
state of tennessee0.090909
LOWER IN pan troglodytes troglodytes0.090909
gorilla gorilla gorilla0.090909
Exp. ID User ID Description Date Region Flag Sequences
620amnondominant saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 7
620amnondominant lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 10
620amnondominant lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 15
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 301
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 357
363amnon high in rumen ruminant reticulum omasum compared to caecum colon rectum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 359
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 383
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 394
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 529
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 963
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1018

Problems / suggestions? Please email info AT dbbact DOT org