Search result for sequence:
TACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGTTTAATAAGTCAGTGGTGAAAGCCCATCGCTCAACGGTGGAACGGCCATTGATACTGTTAAACTTGAATTATTAGGAAGTAACTAGAATATGTAG
common ontology terms
term enrichment score
TermScore
fresh water0.411339
water0.346926
river0.297872
rainbow trout0.206349
oncorhynchus mykiss0.206349
sweden0.171779
skin0.164706
fish0.151603
rhizosphere0.147157
digestive system0.134387
germany0.131148
united states of america0.112880
lake0.107143
depth 1m0.107143
tree0.104348
mississippi river0.096774
china0.095016
filtered 0.2um0.093023
depth 10 cm0.090909
free floating0.088889
soil0.087336
fishmeal diet0.086957
intestine0.079470
canada0.078431
root0.075472
stream0.075472
filtered 2.7um0.075472
fungus growing ant0.074074
fire salamander0.074074
estuary0.074074
estuary water0.074074
bilbao0.074074
jiulong river0.074074
fujian province0.074074
cambridgeshire0.074074
upstream0.074074
panama0.071429
salamandra salamandra0.071429
amphibian larval stage0.071429
mucus0.071429
depth 0.5m0.071429
newt0.071429
lake water0.071429
cultivated environment0.068966
state of minnesota0.066667
united kingdom0.058824
gut content0.056604
cold environment0.056604
koshi river0.056604
salinity <5 ppt0.056604
taxus0.056604
populus0.056604
brassicaceae0.056604
boechera stricta0.056604
state of idaho0.056604
commonwealth of virginia0.055814
kingdom of spain0.055556
jiangxi province0.055046
nepal0.055046
wheat0.055046
spring0.053571
triticum aestivum0.053571
larval stage0.052632
state of tennessee0.052174
LOWER IN summer0.051282
hunan province0.050847
research facility0.050663
frog0.049587
plant0.048387
depth 0-1 meter0.038835
rana catesbeiana0.038835
bullfrog0.038835
warm temperature habitat0.038462
18c0.038462
gastrointestinal system mucosa0.038462
12c0.038462
pond0.038462
tributary0.038462
water pipes0.038462
LOWER IN defatted larvae insect diet0.038462
larvae insect diet0.038462
triturus cristatus0.038462
manganika lake0.038462
LOWER IN lake sediment0.038462
hypereutrophic lake0.038462
sulfidic bottom water0.038462
uppper mississippi river0.038462
mcquade lake0.038462
bank vole0.038462
myodes glareolus0.038462
ukraine0.038462
LOWER IN downstream0.038462
heavy metal0.038462
lower mississippi river0.038462
taxus media0.038462
lissotriton vulgaris0.038462
biofilter0.038462
galium mollugo0.038462
hedge bedstraw0.038462
temperate0.038462
Fraction of dbbact annotations with this term covered by the query
TermScore
canada2.000000
depth 0-1 meter0.666667
filtered 0.2um0.666667
stream0.666667
filtered 2.7um0.666667
rana catesbeiana0.666667
bullfrog0.666667
fresh water0.611111
river0.583333
rainbow trout0.500000
oncorhynchus mykiss0.500000
warm temperature habitat0.500000
18c0.500000
gastrointestinal system mucosa0.500000
fungus growing ant0.500000
atta sexdens0.500000
gut content0.500000
sericomyrmex amabilis0.500000
lake0.500000
photic zone0.500000
12c0.500000
cold environment0.500000
pond0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
mycocepurus smithii0.500000
fire salamander0.500000
water pipes0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
bilbao0.500000
LOWER IN defatted larvae insect diet0.500000
jiulong river0.500000
fujian province0.500000
LOWER IN larvae insect diet0.500000
LOWER IN pre pupae insect diet0.500000
myrmicocrypta ednaella0.500000
qiaamp dna stool mini kit0.500000
leptodactylus latrans0.500000
lesser foam frog0.500000
LOWER IN reproductive organ0.500000
LOWER IN reproductive system0.500000
LOWER IN genitalia0.500000
larvae insect diet0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
chile0.500000
eupsophus vertebralis0.500000
cambridgeshire0.500000
triturus cristatus0.500000
manganika lake0.500000
LOWER IN lake sediment0.500000
hypereutrophic lake0.500000
sulfidic bottom water0.500000
eastern red backed salamander0.500000
plethodon cinereus0.500000
LOWER IN temp 20c0.500000
temp 10c0.500000
bufo bufo0.500000
common toad0.500000
pre-pupae insect diet0.500000
kitchen0.500000
sink0.500000
salinity >20 ppt0.500000
anaxyrus americanus0.500000
american toad0.500000
lake erie0.500000
LOWER IN algal bloom0.500000
depth 1m0.500000
uppper mississippi river0.500000
upstream0.500000
herbivorous beetle0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
mcquade lake0.500000
lithobates catesbeianus0.500000
gulf of naples0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
LOWER IN lower mississippi river0.500000
LOWER IN downstream0.500000
heavy metal0.500000
lower mississippi river0.500000
populated place0.500000
taxus0.500000
taxus media0.500000
LOWER IN taxus cuspidata0.500000
lissotriton vulgaris0.500000
biofilter0.500000
LOWER IN middle0.500000
LOWER IN bottom0.500000
LOWER IN digestive system0.500000
LOWER IN frog0.500000
LOWER IN quasipaa spinosa0.500000
LOWER IN giant spiny frog0.500000
LOWER IN salinity >20 ppt0.500000
Fraction of annotations for the query sequences containing the term
TermScore
water0.380000
fresh water0.310000
united states of america0.300000
river0.200000
digestive system0.170000
china0.170000
sweden0.140000
research facility0.140000
skin0.140000
fish0.130000
rainbow trout0.130000
oncorhynchus mykiss0.130000
rhizosphere0.110000
germany0.080000
adult0.080000
soil0.080000
intestine0.060000
lake0.060000
mississippi river0.060000
depth 1m0.060000
tree0.060000
fishmeal diet0.050000
depth 10 cm0.050000
free floating0.050000
filtered 0.2um0.050000
root0.050000
panama0.040000
fungus growing ant0.040000
canada0.040000
stream0.040000
filtered 2.7um0.040000
salamandra salamandra0.040000
fire salamander0.040000
larval stage0.040000
amphibian larval stage0.040000
mucus0.040000
kingdom of spain0.040000
estuary0.040000
estuary water0.040000
bilbao0.040000
depth 0.5m0.040000
jiulong river0.040000
fujian province0.040000
newt0.040000
cambridgeshire0.040000
united kingdom0.040000
state of minnesota0.040000
lake water0.040000
upstream0.040000
cultivated environment0.040000
gut content0.030000
spring0.030000
LOWER IN summer0.030000
cold environment0.030000
hunan province0.030000
jiangxi province0.030000
koshi river0.030000
nepal0.030000
salinity <5 ppt0.030000
frog0.030000
commonwealth of virginia0.030000
taxus0.030000
state of tennessee0.030000
populus0.030000
brassicaceae0.030000
boechera stricta0.030000
plant0.030000
state of idaho0.030000
triticum aestivum0.030000
wheat0.030000
warm temperature habitat0.020000
18c0.020000
gastrointestinal system mucosa0.020000
depth 0-1 meter0.020000
12c0.020000
pond0.020000
tributary0.020000
wastewater treatment plant0.020000
effluent0.020000
particle bound0.020000
kingdom of the netherlands0.020000
drinking water0.020000
biofilm0.020000
water pipes0.020000
LOWER IN defatted larvae insect diet0.020000
dog0.020000
canis lupus familiaris0.020000
urine0.020000
larvae insect diet0.020000
triturus cristatus0.020000
manganika lake0.020000
LOWER IN sediment0.020000
LOWER IN lake sediment0.020000
hypereutrophic lake0.020000
sulfidic bottom water0.020000
rana catesbeiana0.020000
bullfrog0.020000
winter0.020000
saline water0.020000
uppper mississippi river0.020000
Exp. ID User ID Description Date Region Flag Sequences
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 8
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta sexdens2018-11-14v4No1 / 8
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
392amnonhighfreq fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 9
397amnonhighfreq panama, digestive system, intestine, fungus growing ant, sericomyrmex amabilis2018-11-14v4No1 / 9
169amnon high in spring autumn compared to summer in lake fresh water water canada depth 0-1 meter photic zone 2017-07-24v4No1 / 11
160amnonhigh freq. in river water upstream of WTP effluent in spring in china (highfreq river, water, spring, china)2017-07-12v4No1 / 13
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
315amnonhigh freq. in frog pond water (highfreq hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 13
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
170amnonhighfreq river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 14
397amnoncommon panama, digestive system, intestine, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
200amnonhighfreq. in river downstream of wastewater treatment plant (highfreq river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 15
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
534amnonhighfreq river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
149amnonhighfreq salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 18
178amnonhigh freq. in drinking water pipes biofilm (highfreq kingdom of the netherlands, water, drinking water, biofilm, water pipes)2017-08-10v4No1 / 19
510amnonhighfreq kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 20
392amnon high in fishmeal diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 21
254amnonhighfreq river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 21
392amnon high in fishmeal diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 23
392amnon high in fishmeal diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 24
397amnoncommon panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
492amnoncommon brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 34
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 49
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
492amnoncommon skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 55
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
178amnoncommon in drinking water pipes biofilm (common kingdom of the netherlands, water, drinking water, biofilm, water pipes)2017-08-10v4No1 / 91
508amnon high in water fresh water lake water lake compared to sediment lake sediment in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 91
427amnonlower in salamanders kept at 20C compared to 10C ( high in temp 10c compared to temp 20c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 95
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
254amnon high in winter dry season compared to summer wet season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 153
510amnoncommon kingdom of spain, water, estuary, estuary water, saline water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
508amnoncommon united states of america, state of minnesota, manganika lake, hypereutrophic lake, sulfidic bottom water, water, lake water, fresh water, lake2019-03-17v4No1 / 196
226amnonlower in algal bloom period in lake erie ( high in control compared to algal bloom in water lake lake erie united states of america freshwater lake fresh water )2017-10-29v4No1 / 198
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, uppper mississippi river, upstream, particle, filtered 2.7um2019-01-07v4No1 / 201
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
508amnon high in water lake lake water fresh water compared to sediment lake sediment in united states of america state of minnesota mcquade lake 2019-03-17v4No1 / 214
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, free floating, filtered 0.2um, uppper mississippi river, upstream2019-01-07v4No1 / 219
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
485amnoncommon water, saline water, mediterranean sea, italy, gulf of naples, surface water, depth 0-1 meter, coast, sea water2019-02-19v4No1 / 244
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upper mississippi river upstream compared to lower mississippi river downstream in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 335
508amnoncommon united states of america, state of minnesota, mcquade lake, lake, lake water, fresh water, water2019-03-17v4No1 / 336
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 349
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
134amnon high in taxus media compared to taxus cuspidata in rhizosphere tree taxus china 2017-04-16v4No1 / 358
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
459amnonhigher in surface compared to middle and bottom in aquaculture biofilter sand ( high in surface compared to middle bottom in water fresh water fish farm biofilter sand united states of america state of wisconsin )2019-01-12v4No1 / 448
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, particle, filtered 2.7um, downstream, lower mississippi river2019-01-07v4No1 / 568
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
309amnon high in galium mollugo hedge bedstraw compared to other plants in rhizosphere germany 2018-04-05v4No1 / 618
459amnoncommon in surface in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, surface)2019-01-12v4No1 / 622
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
443amnon high in free floating filtered 0.2um compared to particle filtered 2.7um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 755
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
462amnoncommon united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886

Problems / suggestions? Please email info AT dbbact DOT org