Search result for sequence:
TACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGTTTAATAAGTCAGTGGTGAAAGCCCATCGCTCAACGGTGGAACGGCCATTGATACTGTTAAACTTGAATTATTAGGAAGTAACTAGAATATGTAG
common ontology terms
term enrichment score
TermScore
fresh water0.396051
water0.330914
river0.291363
rainbow trout0.201550
oncorhynchus mykiss0.201550
sweden0.161850
skin0.156775
fish0.138667
rhizosphere0.134557
digestive system0.129936
germany0.124031
united states of america0.106282
lake0.104348
depth 1m0.104348
tree0.101695
mississippi river0.094488
filtered 0.2um0.090498
depth 10 cm0.088496
free floating0.086580
fishmeal diet0.084746
whole body0.084746
china0.084298
soil0.078508
canada0.075472
intestine0.073620
stream0.073394
filtered 2.7um0.073394
fungus growing ant0.072072
fire salamander0.072072
estuary0.072072
estuary water0.072072
bilbao0.072072
jiulong river0.072072
fujian province0.072072
cambridgeshire0.072072
upstream0.072072
root0.071174
panama0.069565
salamandra salamandra0.069565
amphibian larval stage0.069565
mucus0.069565
depth 0.5m0.069565
newt0.069565
lake water0.069565
cultivated environment0.067227
state of minnesota0.062992
united kingdom0.057554
spring0.056604
gut content0.055046
ixodes ricinus0.055046
castor bean tick0.055046
cold environment0.055046
koshi river0.055046
salinity <5 ppt0.055046
taxus0.055046
populus0.055046
brassicaceae0.055046
boechera stricta0.055046
state of idaho0.055046
commonwealth of virginia0.054299
jiangxi province0.053571
nepal0.053571
wheat0.052174
larval stage0.051613
kingdom of spain0.051613
state of tennessee0.050847
triticum aestivum0.050847
LOWER IN summer0.050000
switzerland0.049587
hunan province0.049587
frog0.048387
plant0.047244
research facility0.046129
depth 0-1 meter0.037736
rana catesbeiana0.037736
bullfrog0.037736
warm temperature habitat0.037383
18c0.037383
gastrointestinal system mucosa0.037383
12c0.037383
pond0.037383
tributary0.037383
water pipes0.037383
LOWER IN defatted larvae insect diet0.037383
larvae insect diet0.037383
triturus cristatus0.037383
manganika lake0.037383
LOWER IN lake sediment0.037383
hypereutrophic lake0.037383
sulfidic bottom water0.037383
uppper mississippi river0.037383
poland0.037383
mcquade lake0.037383
bank vole0.037383
myodes glareolus0.037383
ukraine0.037383
LOWER IN downstream0.037383
heavy metal0.037383
lower mississippi river0.037383
taxus media0.037383
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.333333
spring1.000000
depth 0-1 meter0.666667
filtered 0.2um0.666667
stream0.666667
filtered 2.7um0.666667
rana catesbeiana0.666667
bullfrog0.666667
river0.583333
fresh water0.578947
rainbow trout0.500000
oncorhynchus mykiss0.500000
warm temperature habitat0.500000
18c0.500000
gastrointestinal system mucosa0.500000
fungus growing ant0.500000
atta sexdens0.500000
gut content0.500000
sericomyrmex amabilis0.500000
ixodes ricinus0.500000
castor bean tick0.500000
lake0.500000
photic zone0.500000
12c0.500000
cold environment0.500000
pond0.500000
depth 10 cm0.500000
koshi river0.500000
tributary0.500000
mycocepurus smithii0.500000
fire salamander0.500000
water pipes0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
bilbao0.500000
LOWER IN defatted larvae insect diet0.500000
jiulong river0.500000
fujian province0.500000
LOWER IN larvae insect diet0.500000
LOWER IN pre pupae insect diet0.500000
myrmicocrypta ednaella0.500000
qiaamp dna stool mini kit0.500000
leptodactylus latrans0.500000
lesser foam frog0.500000
LOWER IN reproductive organ0.500000
LOWER IN reproductive system0.500000
LOWER IN genitalia0.500000
larvae insect diet0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
chile0.500000
eupsophus vertebralis0.500000
cambridgeshire0.500000
triturus cristatus0.500000
manganika lake0.500000
LOWER IN lake sediment0.500000
hypereutrophic lake0.500000
sulfidic bottom water0.500000
eastern red backed salamander0.500000
plethodon cinereus0.500000
LOWER IN temp 20c0.500000
temp 10c0.500000
bufo bufo0.500000
common toad0.500000
pre-pupae insect diet0.500000
kitchen0.500000
sink0.500000
salinity >20 ppt0.500000
anaxyrus americanus0.500000
american toad0.500000
lake erie0.500000
LOWER IN algal bloom0.500000
depth 1m0.500000
uppper mississippi river0.500000
upstream0.500000
herbivorous beetle0.500000
poland0.500000
LOWER IN detritivorous beetle0.500000
LOWER IN bulgaria0.500000
mcquade lake0.500000
lithobates catesbeianus0.500000
gulf of naples0.500000
bank vole0.500000
myodes glareolus0.500000
ukraine0.500000
LOWER IN lower mississippi river0.500000
LOWER IN downstream0.500000
heavy metal0.500000
lower mississippi river0.500000
populated place0.500000
taxus0.500000
taxus media0.500000
LOWER IN taxus cuspidata0.500000
lissotriton vulgaris0.500000
biofilter0.500000
LOWER IN middle0.500000
LOWER IN bottom0.500000
LOWER IN digestive system0.500000
Fraction of annotations for the query sequences containing the term
TermScore
water0.368932
fresh water0.300971
united states of america0.291262
river0.194175
digestive system0.165049
china0.165049
sweden0.135922
research facility0.135922
skin0.135922
fish0.126214
rainbow trout0.126214
oncorhynchus mykiss0.126214
rhizosphere0.106796
germany0.077670
adult0.077670
soil0.077670
intestine0.058252
lake0.058252
mississippi river0.058252
depth 1m0.058252
tree0.058252
fishmeal diet0.048544
whole body0.048544
depth 10 cm0.048544
free floating0.048544
filtered 0.2um0.048544
root0.048544
panama0.038835
fungus growing ant0.038835
canada0.038835
stream0.038835
filtered 2.7um0.038835
salamandra salamandra0.038835
fire salamander0.038835
larval stage0.038835
amphibian larval stage0.038835
mucus0.038835
kingdom of spain0.038835
estuary0.038835
estuary water0.038835
bilbao0.038835
depth 0.5m0.038835
jiulong river0.038835
fujian province0.038835
newt0.038835
cambridgeshire0.038835
united kingdom0.038835
state of minnesota0.038835
lake water0.038835
upstream0.038835
cultivated environment0.038835
gut content0.029126
ixodes ricinus0.029126
castor bean tick0.029126
switzerland0.029126
spring0.029126
LOWER IN summer0.029126
cold environment0.029126
hunan province0.029126
jiangxi province0.029126
koshi river0.029126
nepal0.029126
salinity <5 ppt0.029126
frog0.029126
commonwealth of virginia0.029126
taxus0.029126
state of tennessee0.029126
populus0.029126
brassicaceae0.029126
boechera stricta0.029126
plant0.029126
state of idaho0.029126
triticum aestivum0.029126
wheat0.029126
warm temperature habitat0.019417
18c0.019417
gastrointestinal system mucosa0.019417
depth 0-1 meter0.019417
12c0.019417
pond0.019417
tributary0.019417
wastewater treatment plant0.019417
effluent0.019417
particle bound0.019417
kingdom of the netherlands0.019417
drinking water0.019417
biofilm0.019417
water pipes0.019417
LOWER IN defatted larvae insect diet0.019417
dog0.019417
canis lupus familiaris0.019417
urine0.019417
larvae insect diet0.019417
triturus cristatus0.019417
manganika lake0.019417
LOWER IN sediment0.019417
LOWER IN lake sediment0.019417
hypereutrophic lake0.019417
sulfidic bottom water0.019417
rana catesbeiana0.019417
Exp. ID User ID Description Date Region Flag Sequences
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 8
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta sexdens2018-11-14v4No1 / 8
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
392amnondominant fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 9
397amnondominant panama, digestive system, intestine, fungus growing ant, sericomyrmex amabilis2018-11-14v4No1 / 9
595amnon high in male compared to female in ixodes ricinus castor bean tick whole body switzerland 2020-03-16v4No1 / 10
169amnon high in spring autumn compared to summer in lake fresh water water canada depth 0-1 meter photic zone 2017-07-24v4No1 / 11
595amnondominant ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 12
160amnonhigh freq. in river water upstream of WTP effluent in spring in china (dominant river, water, spring, china)2017-07-12v4No1 / 13
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
315amnonhigh freq. in frog pond water (dominant hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 13
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, free floating, filtered 0.2um2019-07-22v4No1 / 13
170amnondominant river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 14
397amnoncommon panama, digestive system, intestine, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
200amnonhighfreq. in river downstream of wastewater treatment plant (dominant river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 15
534amnondominant river, water, fresh water, depth 10 cm, koshi river, tributary, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
534amnondominant river, water, fresh water, depth 10 cm, koshi river, nepal, particle bound, filtered 2.7um2019-07-22v4No1 / 16
149amnondominant salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 18
178amnonhigh freq. in drinking water pipes biofilm (dominant kingdom of the netherlands, water, drinking water, biofilm, water pipes)2017-08-10v4No1 / 19
510amnondominant kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 20
392amnon high in fishmeal diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 21
254amnondominant river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 21
392amnon high in fishmeal diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 23
392amnon high in fishmeal diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 24
397amnoncommon panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
492amnoncommon brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 34
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
595amnoncommon ixodes ricinus, castor bean tick, whole body, switzerland2020-03-16v4No1 / 42
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 49
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
492amnoncommon skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 55
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
178amnoncommon in drinking water pipes biofilm (common kingdom of the netherlands, water, drinking water, biofilm, water pipes)2017-08-10v4No1 / 91
508amnon high in water fresh water lake water lake compared to sediment lake sediment in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 91
427amnonlower in salamanders kept at 20C compared to 10C ( high in temp 10c compared to temp 20c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 95
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
199amnoncommon in kitchen sink (common building, urban biome, united states of america, kitchen, sink)2017-10-01v4No1 / 130
254amnon high in winter dry season compared to summer wet season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 153
510amnoncommon kingdom of spain, water, estuary, estuary water, saline water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
170amnoncommon river, water, fresh water, depth 10 cm, united states of america, stream2017-07-24v4No1 / 194
508amnoncommon united states of america, state of minnesota, manganika lake, hypereutrophic lake, sulfidic bottom water, water, lake water, fresh water, lake2019-03-17v4No1 / 196
226amnonlower in algal bloom period in lake erie ( high in control compared to algal bloom in water lake lake erie united states of america freshwater lake fresh water )2017-10-29v4No1 / 198
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, uppper mississippi river, upstream, particle, filtered 2.7um2019-01-07v4No1 / 201
515amnon high in herbivorous beetle poland compared to detritivorous beetle bulgaria in whole body beetle 2019-04-19v4No1 / 205
508amnon high in water lake lake water fresh water compared to sediment lake sediment in united states of america state of minnesota mcquade lake 2019-03-17v4No1 / 214
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, free floating, filtered 0.2um, uppper mississippi river, upstream2019-01-07v4No1 / 219
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
485amnoncommon water, saline water, mediterranean sea, italy, gulf of naples, surface water, depth 0-1 meter, coast, sea water2019-02-19v4No1 / 244
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, spring, china)2017-07-12v4No1 / 278
423amnoncommon bank vole, myodes glareolus, ukraine, skin2018-12-05v4No1 / 291
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upper mississippi river upstream compared to lower mississippi river downstream in mississippi river water river fresh water depth 1m united states of america free floating filtered 0.2um )2019-01-07v4No1 / 335
508amnoncommon united states of america, state of minnesota, mcquade lake, lake, lake water, fresh water, water2019-03-17v4No1 / 336
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 349
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
134amnon high in taxus media compared to taxus cuspidata in rhizosphere tree taxus china 2017-04-16v4No1 / 358
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
459amnonhigher in surface compared to middle and bottom in aquaculture biofilter sand ( high in surface compared to middle bottom in water fresh water fish farm biofilter sand united states of america state of wisconsin )2019-01-12v4No1 / 448
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
443amnoncommon mississippi river, water, river, fresh water, depth 1m, united states of america, particle, filtered 2.7um, downstream, lower mississippi river2019-01-07v4No1 / 568
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
309amnon high in galium mollugo hedge bedstraw compared to other plants in rhizosphere germany 2018-04-05v4No1 / 618
459amnoncommon in surface in aquaculture biofilter sand (common water, fresh water, fish farm, biofilter, sand, united states of america, state of wisconsin, surface)2019-01-12v4No1 / 622
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
443amnon high in free floating filtered 0.2um compared to particle filtered 2.7um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 755
384amnon high in pair of nares nasal cavity compared to oral cavity saliva mouth in equus caballus horse canada farm 2018-10-22v4No1 / 791
462amnoncommon united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
515amnon high in carabidae compared to staphylinidae in whole body beetle carnivorous beetle river poland 2019-04-19v4No1 / 1130
423amnon high in no human contact chernobyl exclusion zone compared to human contact in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 1229
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886

Problems / suggestions? Please email info AT dbbact DOT org