Search result for sequence:
TACGGAGGATCCAAGCGTTATCCGGATTCATTGGGTTTAAAGGGTCCGTAGGCGGATTTTTAAGTCAGTGGTGAAAGCCGACAGCTCAACTGTCGAACTGCCATTGATACTGGAGATCTTGAGTACAAATGAAGTAGGCGGAATGAGTCA
common ontology terms
term enrichment score
TermScore
nan'ao island0.600000
lytechinus variegatus0.285714
LOWER IN marine sediment0.250000
LOWER IN sediment0.222222
state of florida0.117647
sea water0.065934
water0.041379
china0.021661
feces0.009390
Fraction of dbbact annotations with this term covered by the query
TermScore
nan'ao island0.500000
lytechinus variegatus0.333333
LOWER IN marine sediment0.250000
LOWER IN sediment0.200000
state of florida0.076923
sea water0.034483
water0.021277
china0.010989
feces0.004785
Fraction of annotations for the query sequences containing the term
TermScore
nan'ao island0.750000
water0.750000
sea water0.750000
china0.750000
feces0.250000
lytechinus variegatus0.250000
state of florida0.250000
LOWER IN sediment0.250000
LOWER IN marine sediment0.250000

Problems / suggestions? Please email info AT dbbact DOT org