Search result for sequence:
TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGGTCTTTAAGTCAGTGGTGAAAGCCTGCAGCTTAACTGTAGAATTGCCATTGATACTGAAGGCCTTGAGTGTAGTAGAAGTAGGCGGAATATGGCA
common ontology terms
term enrichment score
TermScore
monterey bay0.473684
pacific ocean0.300000
state of california0.272727
depth 5m0.266667
saline water0.216867
surface water0.210526
sea water0.187500
size < 1um0.153846
LOWER IN particle bound0.153846
LOWER IN size 1-80um0.153846
depth 30m0.153846
depth 60m0.153846
LOWER IN depth 75m0.153846
depth 5-50m0.153846
LOWER IN depth 50-100m0.153846
deth 5-100m0.153846
depth 50-100m0.153846
LOWER IN depth 150-500m0.153846
depth 10m0.142857
depth 40m0.142857
LOWER IN depth 300m0.142857
LOWER IN depth 150m0.142857
depth 20m0.133333
free floating0.125000
water0.120000
winter0.076923
LOWER IN summer0.071429
united states of america0.010101
Fraction of dbbact annotations with this term covered by the query
TermScore
depth 5m0.500000
size < 1um0.500000
LOWER IN particle bound0.500000
LOWER IN size 1-80um0.500000
depth 30m0.500000
depth 60m0.500000
LOWER IN depth 75m0.500000
depth 5-50m0.500000
LOWER IN depth 50-100m0.500000
deth 5-100m0.500000
depth 50-100m0.500000
LOWER IN depth 150-500m0.500000
monterey bay0.333333
depth 10m0.333333
depth 40m0.333333
LOWER IN depth 300m0.333333
LOWER IN depth 150m0.333333
depth 20m0.250000
surface water0.250000
free floating0.200000
pacific ocean0.176471
state of california0.157895
saline water0.125000
sea water0.103448
winter0.066667
water0.063830
LOWER IN summer0.058824
united states of america0.005348
Fraction of annotations for the query sequences containing the term
TermScore
water1.000000
pacific ocean1.000000
state of california1.000000
sea water1.000000
saline water0.818182
monterey bay0.818182
depth 5m0.181818
surface water0.181818
depth 10m0.090909
depth 20m0.090909
free floating0.090909
size < 1um0.090909
LOWER IN particle bound0.090909
LOWER IN size 1-80um0.090909
depth 30m0.090909
depth 40m0.090909
depth 60m0.090909
united states of america0.090909
LOWER IN depth 300m0.090909
LOWER IN depth 150m0.090909
LOWER IN depth 75m0.090909
depth 5-50m0.090909
LOWER IN depth 50-100m0.090909
deth 5-100m0.090909
winter0.090909
LOWER IN summer0.090909
depth 50-100m0.090909
LOWER IN depth 150-500m0.090909
Exp. ID User ID Description Date Region Flag Sequences
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 10m, sea water2019-01-16v4No1 / 213
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 5m, sea water2019-01-16v4No1 / 220
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 20m, sea water2019-01-16v4No1 / 225
505amnon high in free floating size < 1um compared to particle bound size 1-80um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 283
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 30m, sea water2019-01-16v4No1 / 293
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 40m, sea water2019-01-16v4No1 / 340
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth 60m, sea water2019-01-16v4No1 / 390
317amnonlower in depth>75m compared to depth >5m in ocean water ( high in surface water depth 5m compared to depth 300m depth 150m depth 75m in water united states of america state of california pacific ocean sea water )2018-04-15v4No1 / 544
473amnon high in depth 5-50m compared to depth 50-100m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 919
473amnon high in winter compared to summer in water saline water pacific ocean state of california monterey bay deth 5-100m sea water 2019-01-16v4No1 / 1006
473amnon high in depth 50-100m compared to depth 150-500m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 1072

Problems / suggestions? Please email info AT dbbact DOT org