Search result for sequence:
TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCAGATAAGTTAGAGGTGAAATTCCGGTGCTTAACACCGGCGCTGCCTCTAATACTGTTTGACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
chicken0.358974
gallus gallus0.343558
age 35 weeks0.300000
hen0.300000
age 5 weeks0.235294
hawaii0.190476
caecum0.184615
broiler chicken0.160000
free range chicken0.153846
age 12 weeks0.153846
LOWER IN age 15-20 weeks0.153846
LOWER IN feral0.153846
china0.153846
jinzhou city prefecture0.153846
perianal skin0.153846
santa catalina island0.153846
urocyon littoralis0.153846
urocyon littoralis catalinae0.153846
santa catalina island fox0.153846
ileal mucosa0.153846
metabolic syndrome0.142857
LOWER IN venezuela0.142857
LOWER IN amerindian0.142857
LOWER IN external acoustic meatus0.133333
LOWER IN ear canal0.133333
LOWER IN hunter gatherer0.133333
LOWER IN digesta0.111111
digesta0.111111
belgium0.105263
kingdom of denmark0.105263
LOWER IN ileum0.093023
rectum0.090909
crohn's disease0.086957
captive0.085106
mucosa0.078431
ileum0.074074
city0.064516
kingdom of spain0.062500
germany0.061224
LOWER IN wild0.057143
wild0.057143
farm0.042553
research facility0.039344
homo sapiens0.021277
feces0.018462
united states of america0.015504
adult0.010870
LOWER IN control0.010204
Fraction of dbbact annotations with this term covered by the query
TermScore
free range chicken0.500000
age 12 weeks0.500000
LOWER IN age 15-20 weeks0.500000
LOWER IN feral0.500000
china0.500000
jinzhou city prefecture0.500000
perianal skin0.500000
santa catalina island0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
ileal mucosa0.500000
age 5 weeks0.333333
metabolic syndrome0.333333
LOWER IN venezuela0.333333
LOWER IN amerindian0.333333
age 35 weeks0.333333
hen0.333333
chicken0.250000
LOWER IN external acoustic meatus0.250000
LOWER IN ear canal0.250000
LOWER IN hunter gatherer0.250000
gallus gallus0.235294
hawaii0.200000
broiler chicken0.142857
LOWER IN digesta0.142857
digesta0.142857
belgium0.125000
kingdom of denmark0.125000
caecum0.111111
rectum0.090909
crohn's disease0.083333
ileum0.062500
LOWER IN ileum0.062500
captive0.055556
city0.050000
mucosa0.050000
kingdom of spain0.047619
LOWER IN wild0.041667
wild0.041667
germany0.034483
farm0.027778
research facility0.020408
homo sapiens0.011070
feces0.009554
united states of america0.008097
adult0.005780
LOWER IN control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
gallus gallus0.636364
chicken0.636364
caecum0.545455
research facility0.545455
feces0.272727
homo sapiens0.272727
germany0.272727
age 35 weeks0.272727
hen0.272727
captive0.181818
broiler chicken0.181818
age 5 weeks0.181818
hawaii0.181818
united states of america0.181818
mucosa0.181818
LOWER IN ileum0.181818
farm0.090909
kingdom of spain0.090909
free range chicken0.090909
age 12 weeks0.090909
crohn's disease0.090909
LOWER IN control0.090909
belgium0.090909
LOWER IN wild0.090909
LOWER IN age 15-20 weeks0.090909
LOWER IN feral0.090909
china0.090909
jinzhou city prefecture0.090909
metabolic syndrome0.090909
adult0.090909
kingdom of denmark0.090909
rectum0.090909
perianal skin0.090909
LOWER IN external acoustic meatus0.090909
LOWER IN ear canal0.090909
wild0.090909
santa catalina island0.090909
urocyon littoralis0.090909
urocyon littoralis catalinae0.090909
santa catalina island fox0.090909
city0.090909
LOWER IN venezuela0.090909
LOWER IN amerindian0.090909
LOWER IN hunter gatherer0.090909
ileal mucosa0.090909
LOWER IN digesta0.090909
ileum0.090909
digesta0.090909
Exp. ID User ID Description Date Region Flag Sequences
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 12 weeks2019-03-03v4No1 / 27
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
776amnon high in research facility captive broiler chicken age 5 weeks compared to wild age 15-20 weeks feral in caecum gallus gallus hawaii chicken 2021-04-25v3No1 / 252
780amnoncommon research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 294
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
776amnoncommon research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 343
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
808amnon high in mucosa ileal mucosa compared to digesta in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 1360
808amnon high in caecum compared to ileum in research facility gallus gallus germany digesta chicken age 35 weeks hen 2021-06-20v1No1 / 1776
808amnon high in caecum compared to ileum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 2147

Problems / suggestions? Please email info AT dbbact DOT org