Search result for sequence:
TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCAGATAAGTTAGAGGTGAAATTCCGGTGCTTAACACCGGCGCTGCCTCTAATACTGTTTGACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
chicken0.329412
gallus gallus0.316384
age 35 weeks0.300000
hen0.260870
age 5 weeks0.235294
hawaii0.190476
caecum0.162162
free range chicken0.153846
age 12 weeks0.153846
LOWER IN age 15-20 weeks0.153846
LOWER IN feral0.153846
jinzhou city prefecture0.153846
perianal skin0.153846
urocyon littoralis0.153846
urocyon littoralis catalinae0.153846
santa catalina island fox0.153846
ileal mucosa0.153846
broiler chicken0.148148
metabolic syndrome0.142857
santa catalina island0.142857
LOWER IN venezuela0.142857
LOWER IN amerindian0.142857
LOWER IN external acoustic meatus0.133333
LOWER IN ear canal0.133333
LOWER IN hunter gatherer0.125000
LOWER IN digesta0.111111
digesta0.111111
belgium0.105263
kingdom of denmark0.100000
rectum0.090909
LOWER IN ileum0.085106
crohn's disease0.080000
captive0.075472
mucosa0.072727
ileum0.068966
kingdom of spain0.062500
city0.060606
germany0.056075
LOWER IN wild0.054054
wild0.054054
farm0.041667
research facility0.035821
homo sapiens0.020000
feces0.016854
united states of america0.014815
china0.010204
adult0.010152
LOWER IN control0.009950
Fraction of dbbact annotations with this term covered by the query
TermScore
free range chicken0.500000
age 12 weeks0.500000
LOWER IN age 15-20 weeks0.500000
LOWER IN feral0.500000
jinzhou city prefecture0.500000
perianal skin0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
ileal mucosa0.500000
age 5 weeks0.333333
metabolic syndrome0.333333
santa catalina island0.333333
LOWER IN venezuela0.333333
LOWER IN amerindian0.333333
age 35 weeks0.333333
LOWER IN external acoustic meatus0.250000
LOWER IN ear canal0.250000
hen0.250000
chicken0.222222
gallus gallus0.210526
hawaii0.200000
LOWER IN hunter gatherer0.200000
LOWER IN digesta0.142857
digesta0.142857
belgium0.125000
broiler chicken0.125000
kingdom of denmark0.111111
caecum0.095238
rectum0.090909
crohn's disease0.071429
ileum0.055556
LOWER IN ileum0.055556
kingdom of spain0.047619
captive0.047619
city0.045455
mucosa0.045455
LOWER IN wild0.038462
wild0.038462
germany0.031250
farm0.027027
research facility0.018519
homo sapiens0.010381
feces0.008696
united states of america0.007722
china0.005405
adult0.005376
LOWER IN control0.005263
Fraction of annotations for the query sequences containing the term
TermScore
gallus gallus0.636364
chicken0.636364
caecum0.545455
research facility0.545455
feces0.272727
homo sapiens0.272727
germany0.272727
age 35 weeks0.272727
hen0.272727
captive0.181818
broiler chicken0.181818
age 5 weeks0.181818
hawaii0.181818
united states of america0.181818
mucosa0.181818
LOWER IN ileum0.181818
farm0.090909
kingdom of spain0.090909
free range chicken0.090909
age 12 weeks0.090909
crohn's disease0.090909
LOWER IN control0.090909
belgium0.090909
LOWER IN wild0.090909
LOWER IN age 15-20 weeks0.090909
LOWER IN feral0.090909
china0.090909
jinzhou city prefecture0.090909
metabolic syndrome0.090909
adult0.090909
kingdom of denmark0.090909
rectum0.090909
perianal skin0.090909
LOWER IN external acoustic meatus0.090909
LOWER IN ear canal0.090909
wild0.090909
santa catalina island0.090909
urocyon littoralis0.090909
urocyon littoralis catalinae0.090909
santa catalina island fox0.090909
city0.090909
LOWER IN venezuela0.090909
LOWER IN amerindian0.090909
LOWER IN hunter gatherer0.090909
ileal mucosa0.090909
LOWER IN digesta0.090909
ileum0.090909
digesta0.090909
Exp. ID User ID Description Date Region Flag Sequences
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 12 weeks2019-03-03v4No1 / 27
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
776amnon high in research facility captive broiler chicken age 5 weeks compared to wild age 15-20 weeks feral in caecum gallus gallus hawaii chicken 2021-04-25v3No1 / 252
780amnoncommon research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 294
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
776amnoncommon research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 343
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
808amnon high in mucosa ileal mucosa compared to digesta in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 1360
808amnon high in caecum compared to ileum in research facility gallus gallus germany digesta chicken age 35 weeks hen 2021-06-20v1No1 / 1776
808amnon high in caecum compared to ileum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 2147

Problems / suggestions? Please email info AT dbbact DOT org