Search result for sequence:
TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATACCGGGGCTCAACTCCGGAACTGCCTCTAATACTGTTGAACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.472393
feces0.459768
adult0.371127
united states of america0.253881
child0.144000
control0.138453
city0.130933
infant0.098361
LOWER IN ulcerative colitis0.098039
research facility0.093750
china0.093325
obsolete_juvenile stage0.089552
age0.084211
heterosexual0.079208
msw0.079208
phascolarctos cinereus0.077670
koala0.077670
cape otway0.077670
LOWER IN crohn's disease0.076923
kingdom of denmark0.074766
rat0.074766
female0.073394
state of colorado0.073394
caecum0.068376
LOWER IN rural community0.060000
czech republic0.059406
biopsy0.058537
wild0.055944
kingdom of spain0.054545
australia0.051613
state of california0.048583
LOWER IN control0.045872
LOWER IN gay0.040816
LOWER IN msm0.040816
LOWER IN homosexual0.040816
wistar rat0.040816
rex rabbit0.040816
irritable bowel syndrome0.040404
eucalyptus viminalis diet0.040404
eucalyptus obliqua diet0.040404
age one year0.040404
commonwealth of pennsylvania0.040404
denver0.040404
toronto0.040404
oslo0.040404
age 30-400.040404
cron diet0.040404
LOWER IN small village0.040404
LOWER IN age < 1 year0.040404
LOWER IN age 30-500.040404
LOWER IN age 60-790.040404
africa0.040404
oryctolagus cuniculus0.040404
LOWER IN infant0.040000
state of oklahoma0.039604
caloric restriction diet0.039604
rattus0.039604
india0.039604
state of michigan0.039216
finland0.039216
rattus norvegicus0.039216
biopsy site0.038835
rectum0.038462
kingdom of norway0.036036
LOWER IN adult0.035714
LOWER IN male0.034188
mouse0.027778
mus musculus0.026490
clostridium difficile colitis0.020619
mus musculoides0.020619
nyulmc0.020619
nod/shiltj (no. 001976, jackson labs)0.020619
male0.020619
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.020619
LOWER IN endospore enriched fraction0.020619
LOWER IN lysis0.020619
age 17-290.020619
quito0.020619
age 200.020619
LOWER IN egypt0.020619
interferon gamma knockout0.020619
age one month0.020619
LOWER IN age one week0.020619
LOWER IN inflammatory bowel disease0.020619
mild0.020619
LOWER IN severe0.020619
thailand0.020619
hmong0.020619
LOWER IN karen0.020619
LOWER IN myanmar0.020619
age 130.020619
LOWER IN india0.020619
glasgow0.020619
dnbs induced colitis0.020619
age<17 years0.020619
LOWER IN peru0.020619
LOWER IN tunapuco0.020619
age 1-3 years0.020619
deinagkistrodon acutus0.020619
pit viper0.020619
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN ulcerative colitis0.714286
heterosexual0.666667
msw0.666667
LOWER IN gay0.666667
LOWER IN msm0.666667
LOWER IN homosexual0.666667
wistar rat0.666667
rex rabbit0.666667
LOWER IN rural community0.600000
clostridium difficile colitis0.500000
irritable bowel syndrome0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
eucalyptus viminalis diet0.500000
eucalyptus obliqua diet0.500000
mus musculoides0.500000
nyulmc0.500000
nod/shiltj (no. 001976, jackson labs)0.500000
male0.500000
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
age one year0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
quito0.500000
denver0.500000
age 200.500000
LOWER IN egypt0.500000
interferon gamma knockout0.500000
age one month0.500000
LOWER IN age one week0.500000
LOWER IN inflammatory bowel disease0.500000
mild0.500000
LOWER IN severe0.500000
toronto0.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
thailand0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
LOWER IN india0.500000
glasgow0.500000
czech republic0.500000
dnbs induced colitis0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
deinagkistrodon acutus0.500000
pit viper0.500000
snake farm0.500000
adula0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
canada0.500000
atherosclerosis0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
age 19-240.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
age 1-20.500000
LOWER IN age 0-10.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
dahl salt-sensitive0.500000
LOWER IN short bowel syndrome0.500000
LOWER IN thailand0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sigmoid colon0.500000
children0.500000
age >940.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
LOWER IN age <1 year0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.915789
homo sapiens0.810526
united states of america0.484211
adult0.389474
control0.178947
research facility0.094737
child0.094737
china0.094737
city0.084211
infant0.063158
LOWER IN control0.052632
LOWER IN ulcerative colitis0.052632
obsolete_juvenile stage0.052632
female0.052632
age0.052632
phascolarctos cinereus0.042105
koala0.042105
australia0.042105
wild0.042105
cape otway0.042105
kingdom of denmark0.042105
state of colorado0.042105
heterosexual0.042105
msw0.042105
caecum0.042105
LOWER IN crohn's disease0.042105
rat0.042105
kingdom of spain0.031579
state of california0.031579
biopsy0.031579
czech republic0.031579
LOWER IN rural community0.031579
irritable bowel syndrome0.021053
eucalyptus viminalis diet0.021053
eucalyptus obliqua diet0.021053
age one year0.021053
commonwealth of pennsylvania0.021053
state of michigan0.021053
denver0.021053
biopsy site0.021053
mus musculus0.021053
mouse0.021053
LOWER IN gay0.021053
LOWER IN msm0.021053
LOWER IN homosexual0.021053
state of oklahoma0.021053
toronto0.021053
LOWER IN adult0.021053
kingdom of norway0.021053
oslo0.021053
age 30-400.021053
cron diet0.021053
caloric restriction diet0.021053
finland0.021053
LOWER IN male0.021053
LOWER IN infant0.021053
rattus0.021053
wistar rat0.021053
LOWER IN small village0.021053
LOWER IN age < 1 year0.021053
rattus norvegicus0.021053
rectum0.021053
LOWER IN age 30-500.021053
LOWER IN age 60-790.021053
india0.021053
africa0.021053
oryctolagus cuniculus0.021053
rex rabbit0.021053
humanized mouse0.010526
clostridium difficile intestinal infectious disease0.010526
clostridium difficile colitis0.010526
mus musculoides0.010526
nyulmc0.010526
nod/shiltj (no. 001976, jackson labs)0.010526
male0.010526
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.010526
LOWER IN antibiotic0.010526
LOWER IN endospore enriched fraction0.010526
LOWER IN lysis0.010526
LOWER IN hiv infection0.010526
age 17-290.010526
state of ohio0.010526
age 5-13 years0.010526
ecuador0.010526
quito0.010526
commonwealth of virginia0.010526
state of arizona0.010526
age 200.010526
LOWER IN egypt0.010526
right colon0.010526
c57bl/6j0.010526
interferon gamma knockout0.010526
age one month0.010526
LOWER IN age one week0.010526
LOWER IN child0.010526
LOWER IN inflammatory bowel disease0.010526
belgium0.010526
mild0.010526
LOWER IN severe0.010526
left colon0.010526
Exp. ID User ID Description Date Region Flag Sequences
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile intestinal infectious disease clostridium difficile colitis compared to control in humanized mouse feces united states of america research facility )2018-04-29v4No1 / 4
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 9
541amnonhighfreq phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 16
541amnonhighfreq phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 23
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v4No1 / 26
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 69
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
562amnoncommon age 5-13 years, child, ecuador, quito, feces2019-11-05v4No1 / 82
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 100
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
264amnoncommon oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 622
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
88amnoncommon syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v4No1 / 891

Problems / suggestions? Please email info AT dbbact DOT org