Search result for sequence:
TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATACCGGGGCTCAACTCCGGAACTGCCTCTAATACTGTTGAACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.486819
feces0.460393
adult0.375652
united states of america0.252992
control0.143894
city0.133111
child0.133111
LOWER IN ulcerative colitis0.100000
infant0.100000
china0.096000
research facility0.094737
obsolete_juvenile stage0.091185
age0.085653
heterosexual0.080808
msw0.080808
cape otway0.079208
koala0.079208
phascolarctos cinereus0.079208
LOWER IN crohn's disease0.078431
kingdom of denmark0.076190
rat0.076190
female0.075188
state of colorado0.074766
caecum0.070175
czech republic0.061224
LOWER IN rural community0.061224
biopsy0.059701
wild0.056738
kingdom of spain0.055556
australia0.052288
state of california0.049383
LOWER IN control0.047619
LOWER IN gay0.041667
LOWER IN msm0.041667
LOWER IN homosexual0.041667
wistar rat0.041667
rex rabbit0.041667
irritable bowel syndrome0.041237
eucalyptus viminalis diet0.041237
eucalyptus obliqua diet0.041237
age one year0.041237
commonwealth of pennsylvania0.041237
denver0.041237
toronto0.041237
oslo0.041237
age 30-400.041237
cron diet0.041237
LOWER IN small village0.041237
LOWER IN age < 1 year0.041237
LOWER IN age 30-500.041237
LOWER IN age 60-790.041237
africa0.041237
oryctolagus cuniculus0.041237
LOWER IN infant0.040816
state of oklahoma0.040404
caloric restriction diet0.040404
rattus0.040404
india0.040404
state of michigan0.040000
finland0.040000
rattus norvegicus0.040000
biopsy site0.039604
rectum0.039216
kingdom of norway0.036697
LOWER IN adult0.036364
LOWER IN male0.034783
mouse0.028169
mus musculus0.026846
clostridium difficile colitis0.021053
mus musculoides0.021053
nyulmc0.021053
nod/shiltj (no. 001976, jackson labs)0.021053
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.021053
LOWER IN endospore enriched fraction0.021053
LOWER IN lysis0.021053
age 17-290.021053
age 200.021053
LOWER IN egypt0.021053
interferon gamma knockout0.021053
age one month0.021053
LOWER IN age one week0.021053
LOWER IN inflammatory bowel disease0.021053
mild0.021053
LOWER IN severe0.021053
thailand0.021053
hmong0.021053
LOWER IN karen0.021053
LOWER IN myanmar0.021053
LOWER IN india0.021053
age 130.021053
glasgow0.021053
dnbs induced colitis0.021053
age<17 years0.021053
LOWER IN peru0.021053
LOWER IN tunapuco0.021053
age 1-3 years0.021053
adula0.021053
snake farm0.021053
pit viper0.021053
deinagkistrodon acutus0.021053
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN ulcerative colitis0.714286
heterosexual0.666667
msw0.666667
LOWER IN gay0.666667
LOWER IN msm0.666667
LOWER IN homosexual0.666667
wistar rat0.666667
rex rabbit0.666667
czech republic0.600000
LOWER IN rural community0.600000
clostridium difficile colitis0.500000
irritable bowel syndrome0.500000
eucalyptus viminalis diet0.500000
cape otway0.500000
koala0.500000
phascolarctos cinereus0.500000
eucalyptus obliqua diet0.500000
mus musculoides0.500000
nyulmc0.500000
nod/shiltj (no. 001976, jackson labs)0.500000
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
age one year0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
denver0.500000
age 200.500000
LOWER IN egypt0.500000
interferon gamma knockout0.500000
age one month0.500000
LOWER IN age one week0.500000
LOWER IN inflammatory bowel disease0.500000
mild0.500000
LOWER IN severe0.500000
toronto0.500000
oslo0.500000
age 30-400.500000
cron diet0.500000
thailand0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
LOWER IN india0.500000
age 130.500000
glasgow0.500000
dnbs induced colitis0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
adula0.500000
snake farm0.500000
pit viper0.500000
deinagkistrodon acutus0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
atherosclerosis0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
age 19-240.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age >940.500000
soldiers0.500000
age 1-20.500000
LOWER IN age 0-10.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nanchang city prefecture0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
dahl salt-sensitive0.500000
LOWER IN short bowel syndrome0.500000
LOWER IN thailand0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sigmoid colon0.500000
children0.500000
age >940.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
LOWER IN age <1 year0.500000
bilbao0.500000
estuary0.500000
estuary water0.500000
salinity <5 ppt0.500000
LOWER IN salinity >20 ppt0.500000
oryctolagus cuniculus0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.913978
homo sapiens0.817204
united states of america0.483871
adult0.387097
control0.182796
research facility0.096774
china0.096774
city0.086022
child0.086022
infant0.064516
LOWER IN control0.053763
LOWER IN ulcerative colitis0.053763
obsolete_juvenile stage0.053763
female0.053763
age0.053763
cape otway0.043011
wild0.043011
australia0.043011
koala0.043011
phascolarctos cinereus0.043011
kingdom of denmark0.043011
state of colorado0.043011
heterosexual0.043011
msw0.043011
caecum0.043011
LOWER IN crohn's disease0.043011
rat0.043011
kingdom of spain0.032258
state of california0.032258
biopsy0.032258
czech republic0.032258
LOWER IN rural community0.032258
irritable bowel syndrome0.021505
eucalyptus viminalis diet0.021505
eucalyptus obliqua diet0.021505
age one year0.021505
commonwealth of pennsylvania0.021505
state of michigan0.021505
denver0.021505
biopsy site0.021505
mus musculus0.021505
mouse0.021505
LOWER IN gay0.021505
LOWER IN msm0.021505
LOWER IN homosexual0.021505
state of oklahoma0.021505
toronto0.021505
LOWER IN adult0.021505
kingdom of norway0.021505
oslo0.021505
age 30-400.021505
cron diet0.021505
caloric restriction diet0.021505
finland0.021505
LOWER IN male0.021505
LOWER IN infant0.021505
rattus0.021505
wistar rat0.021505
LOWER IN small village0.021505
LOWER IN age < 1 year0.021505
rattus norvegicus0.021505
rectum0.021505
LOWER IN age 30-500.021505
LOWER IN age 60-790.021505
india0.021505
africa0.021505
oryctolagus cuniculus0.021505
rex rabbit0.021505
humanized mouse0.010753
clostridium difficile intestinal infectious disease0.010753
clostridium difficile colitis0.010753
mus musculoides0.010753
nyulmc0.010753
nod/shiltj (no. 001976, jackson labs)0.010753
male0.010753
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.010753
LOWER IN antibiotic0.010753
LOWER IN endospore enriched fraction0.010753
LOWER IN lysis0.010753
LOWER IN hiv infection0.010753
age 17-290.010753
state of ohio0.010753
commonwealth of virginia0.010753
state of arizona0.010753
age 200.010753
LOWER IN egypt0.010753
right colon0.010753
c57bl/6j0.010753
interferon gamma knockout0.010753
age one month0.010753
LOWER IN age one week0.010753
LOWER IN child0.010753
LOWER IN inflammatory bowel disease0.010753
belgium0.010753
mild0.010753
LOWER IN severe0.010753
left colon0.010753
lean body mass0.010753
thailand0.010753
rural community0.010753
Exp. ID User ID Description Date Region Flag Sequences
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile intestinal infectious disease clostridium difficile colitis compared to control in humanized mouse feces united states of america research facility )2018-04-29v4No1 / 4
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 9
541amnonhighfreq eucalyptus viminalis diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 16
541amnonhighfreq eucalyptus obliqua diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 23
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v4No1 / 26
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 69
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
541amnoncommon eucalyptus viminalis diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 72
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
541amnoncommon eucalyptus obliqua diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 77
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 77
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 100
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
273amnon high in age age one month compared to age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in colitis dnbs induced colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
530amnoncommon hunan province, adula, china, farm, snake farm, feces, pit viper, deinagkistrodon acutus, snake2019-07-21v4No1 / 178
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
264amnoncommon oryctolagus cuniculus, rex rabbit, china, caecum, research facility, jiangsu province2017-12-11v4No1 / 622
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
88amnoncommon syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v4No1 / 891

Problems / suggestions? Please email info AT dbbact DOT org