Search result for sequence:
TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.654024
feces0.650691
adult0.425373
united states of america0.323224
china0.196570
research facility0.168408
control0.149325
child0.133581
infant0.121045
city0.108606
rat0.096038
female0.095238
caecum0.081538
mus musculus0.080920
jiangsu province0.076471
obsolete_juvenile stage0.075036
kingdom of spain0.069767
australia0.064171
mouse0.061935
diarrhea0.059289
rattus norvegicus0.055113
sprague dawley0.055113
colombia0.049383
age < 3 years0.049080
state of california0.048900
state of colorado0.046784
rattus0.043424
biopsy0.042989
czech republic0.042989
rectum0.042456
colon0.040521
male0.040317
clostridium difficile intestinal infectious disease0.037325
msw0.037152
heterosexual0.037152
LOWER IN crohn's disease0.037152
rural community0.036980
kingdom of denmark0.036810
state of michigan0.036585
ulcerative colitis0.036585
finland0.036585
israel0.036145
crohn's disease0.036145
united kingdom0.036145
water0.035646
hospital0.034286
LOWER IN control0.032483
biopsy site0.030864
cape otway0.030864
koala0.030864
phascolarctos cinereus0.030864
commonwealth of pennsylvania0.030864
india0.030864
age0.030030
kingdom of norway0.029940
fresh water0.029211
wild0.026738
oryctolagus cuniculus0.025052
colitis0.024948
LOWER IN ulcerative colitis0.024922
sea urchin0.024845
nanchang city prefecture0.024845
age 50-60 years0.024845
nanning city prefecture0.024845
guangzhou city prefecture0.024845
oslo0.024845
denver0.024845
lytechinus variegatus0.024540
sichuan province0.024540
age 1 year0.024540
river0.024242
commonwealth of virginia0.023952
state of florida0.023669
farm0.022346
age 6 weeks0.018838
metabolic syndrome0.018838
state of oklahoma0.018838
wistar rat0.018838
rex rabbit0.018838
LOWER IN rural community0.018809
eagle harbor0.018750
age >940.018750
free range chicken0.018750
eucalyptus viminalis diet0.018750
cron diet0.018750
age 19-240.018750
atherosclerosis0.018750
age one year0.018750
age<17 years0.018750
age 3-60.018750
africa0.018750
obesity0.018750
bilbao0.018750
estuary0.018750
estuary water0.018750
wastewater treatment plant0.018750
effluent0.018750
caloric restriction diet0.018576
atlanta0.018576
mouse chow0.018519
Fraction of dbbact annotations with this term covered by the query
TermScore
rat0.833333
rattus0.833333
clostridium difficile intestinal infectious disease0.800000
colombia0.800000
oryctolagus cuniculus0.750000
rattus norvegicus0.714286
sprague dawley0.714286
age 6 weeks0.666667
age < 3 years0.666667
msw0.666667
heterosexual0.666667
metabolic syndrome0.666667
LOWER IN crohn's disease0.666667
state of oklahoma0.666667
lean body mass0.666667
homosexual0.666667
gay0.666667
msm0.666667
LOWER IN gay0.666667
LOWER IN msm0.666667
LOWER IN homosexual0.666667
wistar rat0.666667
rex rabbit0.666667
biopsy0.600000
czech republic0.600000
colitis0.600000
LOWER IN rural community0.600000
homo sapiens0.573333
rural community0.571429
LOWER IN ulcerative colitis0.571429
child0.529412
city0.529412
feces0.528205
adult0.513514
clostridium difficile colitis0.500000
tursiops truncatus0.500000
bottlenosed dolphin0.500000
sea urchin0.500000
eagle harbor0.500000
age >940.500000
jiangsu province0.500000
biopsy site0.500000
schizophrenia0.500000
azerbaijan0.500000
free range chicken0.500000
eucalyptus viminalis diet0.500000
cape otway0.500000
koala0.500000
phascolarctos cinereus0.500000
cron diet0.500000
irritable bowel syndrome0.500000
nanchang city prefecture0.500000
age 200.500000
age 19-240.500000
age 60-790.500000
atherosclerosis0.500000
daycare0.500000
age 1-5 years0.500000
kingdom of denmark0.500000
age one year0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
guangzhou city prefecture0.500000
salmonella gastroenteritis0.500000
age 17-290.500000
oslo0.500000
age 30-400.500000
jordan0.500000
LOWER IN type i diabetes mellitus0.500000
age<17 years0.500000
stroke0.500000
commonwealth of pennsylvania0.500000
inflammatory bowel disease0.500000
toronto0.500000
estonia0.500000
denver0.500000
eucalyptus obliqua diet0.500000
mouse strain c57bc/6ncrl0.500000
immunization heat killed mycobacterium vaccae0.500000
LOWER IN vehicle bbs0.500000
short bowel syndrome0.500000
eucalyptus viminalis0.500000
LOWER IN eucalyptus obliqua diet0.500000
LOWER IN eucalyptus obliqua0.500000
age 6 months0.500000
pancreatitis0.500000
acute pancreatitis0.500000
age 30-500.500000
age 8-120.500000
age 13-140.500000
age 3-60.500000
india0.500000
induced sputum0.500000
LOWER IN bronchial brush0.500000
LOWER IN bronchus0.500000
LOWER IN bronchial epithelium0.500000
LOWER IN milk0.500000
plant diet0.500000
sigmoid colon0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.847134
homo sapiens0.761146
united states of america0.369427
adult0.363057
china0.191083
research facility0.130573
control0.121019
child0.076433
infant0.070064
city0.060510
female0.057325
mus musculus0.050955
rat0.050955
caecum0.044586
jiangsu province0.041401
obsolete_juvenile stage0.041401
kingdom of spain0.038217
australia0.038217
mouse0.038217
diarrhea0.031847
state of california0.031847
rattus norvegicus0.028662
sprague dawley0.028662
colombia0.025478
age < 3 years0.025478
state of colorado0.025478
LOWER IN control0.022293
biopsy0.022293
rectum0.022293
czech republic0.022293
male0.022293
colon0.022293
rattus0.022293
water0.022293
clostridium difficile intestinal infectious disease0.019108
israel0.019108
state of michigan0.019108
rural community0.019108
kingdom of denmark0.019108
ulcerative colitis0.019108
crohn's disease0.019108
hospital0.019108
united kingdom0.019108
finland0.019108
msw0.019108
heterosexual0.019108
LOWER IN crohn's disease0.019108
biopsy site0.015924
cape otway0.015924
wild0.015924
koala0.015924
phascolarctos cinereus0.015924
kingdom of norway0.015924
commonwealth of pennsylvania0.015924
india0.015924
age0.015924
fresh water0.015924
sea urchin0.012739
lytechinus variegatus0.012739
state of florida0.012739
farm0.012739
commonwealth of virginia0.012739
sichuan province0.012739
nanchang city prefecture0.012739
age 50-60 years0.012739
nanning city prefecture0.012739
guangzhou city prefecture0.012739
oslo0.012739
age 1 year0.012739
denver0.012739
LOWER IN ulcerative colitis0.012739
colitis0.012739
oryctolagus cuniculus0.012739
river0.012739
skin0.009554
eagle harbor0.009554
age >940.009554
gallus gallus0.009554
chicken0.009554
free range chicken0.009554
age 6 weeks0.009554
eucalyptus viminalis diet0.009554
cron diet0.009554
caloric restriction diet0.009554
age 19-240.009554
canada0.009554
atherosclerosis0.009554
age one year0.009554
age<17 years0.009554
atlanta0.009554
metabolic syndrome0.009554
south korea0.009554
age 3-60.009554
diet0.009554
texas0.009554
LOWER IN male0.009554
state of oklahoma0.009554
africa0.009554
obesity0.009554
germany0.009554
Exp. ID User ID Description Date Region Flag Sequences
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile intestinal infectious disease clostridium difficile colitis compared to control in humanized mouse feces united states of america research facility )2018-04-29v4No1 / 4
207amnoncommon in people hospitalized with diarrhea (common homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 7
79amnonhighfreq skin, united states of america, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 10
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, digestive system2018-07-30v4No1 / 11
438amnonhighfreq feces, homo sapiens, china, age >94, adult, jiangsu province2018-12-30v4No1 / 14
74amnonhighfreq united states of america, feces, homo sapiens2017-02-27v4No1 / 15
79amnoncommon skin, united states of america, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
409amnonhighfreq homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
502amnonhighfreq homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 15
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
310amnonhighfreq homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 16
365amnonhighfreq homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
495amnonhighfreq gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 16
532amnonhighfreq control, adult, czech republic, feces, homo sapiens2019-07-21v1No1 / 16
541amnonhighfreq eucalyptus viminalis diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 16
289amnonhighfreq homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 17
290amnonhighfreq homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 17
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
400amnonhigh freq. in feces of european american females (highfreq homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 17
36amnonhighfreq homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (highfreq homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
215amnonhighfreq homo sapiens, feces, united states of america2017-10-23v4No1 / 18
293amnonhighfreq homo sapiens, feces, adult, united states of america, cron diet, caloric restriction diet2018-02-07v4No1 / 18
294amnonhighfreq homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (highfreq homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 18
368amnonhighfreq feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
428amnonhighfreq homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 18
430amnonhighfreq homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 18
292amnonhighfreq homo sapiens, china, adult, feces, control2018-02-05v4No1 / 19
401amnonhighfreq homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 19
438amnonhighfreq homo sapiens, feces, china, age 19-242018-12-30v4No1 / 19
438amnonhighfreq feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 19
449amnonhighfreq homo sapiens, feces, colombia2019-01-09v4No1 / 19
455amnonhighfreq homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhighfreq homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 19
482amnonhighfreq homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 19
516amnonhighfreq adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 19
273amnonhighfreq feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (highfreq homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 20
292amnonhighfreq homo sapiens, china, adult, feces, ulcerative colitis2018-02-05v4No1 / 20
292amnonhighfreq homo sapiens, china, adult, feces, crohn's disease2018-02-05v4No1 / 20
333amnonhigh freq. in healthy controls feces (highfreq homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 20
390amnonhighfreq homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 20
390amnonhighfreq homo sapiens, feces, diarrhea, australia, hospital2018-11-04v4No1 / 20
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
409amnonhighfreq homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
484amnonhighfreq feces, adult, age 17-29, united states of america, state of michigan, homo sapiens2019-02-13v4No1 / 20
122amnonhighfreq homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
240amnonhigh freq. in infants age <3 years (highfreq homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (highfreq homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 21
249amnonhighfreq homo sapiens, feces, united states of america2017-11-22v4No1 / 21
320amnonhighfreq homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
390amnonhighfreq homo sapiens, feces, diarrhea, clostridium difficile intestinal infectious disease, australia, hospital2018-11-04v4No1 / 21
393amnonhighfreq homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (highfreq homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
409amnonhighfreq homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
94amnonhighfreq homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
120amnonhighfreq homo sapiens, feces, brazil2017-04-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (highfreq homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
284amnonhighfreq homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (highfreq homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 22
293amnonhighfreq homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
297amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
333amnonhigh freq. in stroke patient feces (highfreq homo sapiens, feces, china, guangzhou city prefecture, adult, stroke)2018-05-15v4No1 / 22
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
467amnonhighfreq homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
502amnonhighfreq homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
10amnonhighfreq homo sapiens, feces, toronto2016-10-27v4No1 / 23
132amnonhighfreq homo sapiens, feces, united states of america2017-04-16v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (highfreq homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (highfreq homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 23
284amnonhighfreq homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (highfreq homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
394amnonhighfreq homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
541amnonhighfreq eucalyptus obliqua diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 23
47amnonsmj: higher in mice immunized with M. vaccae ( high in immunization heat killed mycobacterium vaccae vaccination compared to vehicle bbs in feces united states of america mus musculus male mouse strain c57bc/6ncrl research facility )2017-01-13v4No1 / 24
239amnonhighfreq homo sapiens, feces, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
330amnonhighfreq homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
395amnonhighfreq homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
532amnoncommon short bowel syndrome, adult, czech republic, feces, homo sapiens2019-07-21v1No1 / 24
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis diet eucalyptus viminalis compared to eucalyptus obliqua diet eucalyptus obliqua in cape otway wild australia feces koala phascolarctos cinereus )2019-08-01v4No1 / 24
284amnoncommon homo sapiens, female, feces, state of california, infant, age 6 months2018-01-27v4No1 / 25
290amnonhighfreq homo sapiens, feces, china, adult, city2018-02-01v4No1 / 25
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, pancreatitis, acute pancreatitis2018-12-09v4No1 / 25
62amnonhighfreq homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
438amnonhighfreq feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 26
131amnonhighfreq homo sapiens, feces, south korea2017-04-16v4No1 / 27
438amnonhighfreq homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 27
319amnonhighfreq homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 28
438amnonhighfreq homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 29
284amnoncommon homo sapiens, female, feces, state of california, infant, age 1 year2018-01-27v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
438amnonhighfreq homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, india, infant)2016-12-19v4No1 / 31
390amnoncommon homo sapiens, feces, diarrhea, clostridium difficile intestinal infectious disease, australia, hospital2018-11-04v4No1 / 31
354amnon high in sputum induced sputum compared to bronchial brush bronchus bronchial epithelium in homo sapiens united states of america adult 2018-07-30v4No1 / 32
24amnondisappears on transition to cow milk ( high in breast milk compared to milk in homo sapiens feces infant )2016-12-01v4No1 / 35
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 38
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital2018-11-04v4No1 / 38
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 42
108amnoncommon research facility, texas, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 43
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, age 1-5 years2019-02-12v4No1 / 47
292amnoncommon homo sapiens, china, adult, feces, ulcerative colitis2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, china, stroke, adult, guangzhou city prefecture)2018-05-15v4No1 / 53
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
292amnoncommon homo sapiens, china, adult, feces, crohn's disease2018-02-05v4No1 / 55
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital, salmonella gastroenteritis2018-11-04v4No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
333amnoncommon in healthy controls feces (common homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-15v4No1 / 61
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility china feces )2019-01-06v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in rattus sprague dawley rat feces china research facility )2017-10-25v4No1 / 68
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america mus musculus male mouse strain c57bc/6ncrl research facility no immunization: vehicle as control )2017-01-13v4No1 / 70
541amnoncommon eucalyptus viminalis diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 72
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-29v4No1 / 77
541amnoncommon eucalyptus obliqua diet, cape otway, wild, australia, feces, koala, phascolarctos cinereus2019-08-01v4No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
292amnoncommon homo sapiens, china, adult, feces, control2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-21v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v4No1 / 88
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-09v4No1 / 93
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
532amnoncommon control, adult, czech republic, feces, homo sapiens2019-07-21v1No1 / 98
455amnoncommon homo sapiens, adult, canada, atherosclerosis, saliva2019-01-10v4No1 / 100
438amnoncommon homo sapiens, feces, china, age 19-242018-12-30v4No1 / 101
108amnon high in colon compared to caecum in research facility texas united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, china, age 60-79, adult, jiangsu province2018-12-30v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-30v4No1 / 115
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age age 3 months compared to age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 117
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-30v4No1 / 121
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-26v4No1 / 125
522amnoncommon high sugar diet, age 18 weeks, janvier labs, c57bl/6j, female, research facility, germany, feces, mus musculus, mouse2019-07-03v3No1 / 126
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
522amnoncommon mouse chow, age 6 weeks, janvier labs, c57bl/6j, female, research facility, germany, feces, mus musculus, mouse2019-07-03v3No1 / 130
526amnon high in cholelithiasis compared to control in kingdom of spain adult bile gallbladder homo sapiens 2019-07-14v3No1 / 131
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obesity, obese body mass index status, db/db mouse2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 139
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
300amnoncommon rat, rattus norvegicus, caecum, female, ovariectomy, age 38 weeks, united states of america, research facility2018-02-27v4No1 / 150
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in colitis dnbs induced colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
526amnoncommon in bile of Cholelithiasis patients (common cholelithiasis, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, saline water, salinity >20 ppt2019-03-20v4No1 / 158
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens china adult feces 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, china, adult, city2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
179amnoncommon mus musculus, mouse, oral cavity, mouth, research facility, united states of america, balb/c2017-08-13v4No1 / 183
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-09v4No1 / 197
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-01v4No1 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 233
349amnoncommon rattus, rat, feces, china, research facility, sprague dawley, male2018-07-29v4No1 / 235
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in age 19-24 soldiers compared to adult age 30-50 age 60-79 age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-27v4No1 / 239
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-19v4No1 / 253
419amnoncommon rat, rattus norvegicus, sprague dawley, china, research facility, feces2018-12-02v4No1 / 254
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
78amnonhigher in older gazelles ( high in age old age compared to young age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 273
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, united kingdom, polga mutant)2017-10-29v4No1 / 281
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-09v4No1 / 288
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, china, research facility, feces, constipation)2018-12-02v4No1 / 300
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
80amnoncommon feces, woodland, central america, alouatta palliata, mantled howler monkey2017-03-03v4No1 / 309
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces woodland central america alouatta palliata mantled howler monkey 2017-03-03v4No1 / 314
13amnon high in caecum colon rectum feces compared to mouth esophagus stomach duodenum ileum in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 316
510amnoncommon kingdom of spain, water, bilbao, estuary, estuary water, fresh water, salinity <5 ppt2019-03-20v4No1 / 317
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in angus steer post-weaning state of georgia united states of america feces cow bos taurus )2019-06-11v4No1 / 325
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
111amnoncommon mongolian sheep, china, ovis aries, rectum, ileum, cecum, colon2017-04-09v4No1 / 330
532amnon high in control compared to short bowel syndrome in adult czech republic feces homo sapiens 2019-07-21v1No1 / 334
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in age 2-4 weeks preweaned suckling compared to age 4-7 weeks corn and soybean diet weaned in jiangxi province farm china feces sus scrofa pig )2019-07-02v3No1 / 347
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river china water fresh water depth 0.5m jiulong river fujian province )2017-11-23v4No1 / 356
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, china, feces, colitis, tnbs)2019-01-06v4No1 / 360
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, united kingdom, wild type genotype)2017-10-29v4No1 / 370
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, china, water, autumn)2017-07-12v4No1 / 376
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, china, feces2019-01-06v4No1 / 378
108amnon high in caecum compared to colon in research facility texas united states of america coturnix coturnix common quail 2017-04-07v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep china ovis aries 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common china, autumn, wastewater treatment plant, effluent)2017-07-12v4No1 / 469
221amnoncommon rattus, sprague dawley, rat, feces, china, research facility2017-10-25v4No1 / 470
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
214amnon high in diet nih 31m chow mouse chow compared to high fat diet in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 495
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common china, wastewater treatment plant, effluent, spring)2017-07-12v4No1 / 573
399amnoncommon feces, united states of america, oryctolagus cuniculus, rabbit, research facility2018-11-16v4No1 / 577
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
254amnon high in summer wet season compared to fall winter dry season in river china water fresh water depth 0.5m jiulong river fujian province 2017-11-23v4No1 / 581
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water bilbao estuary estuary water 2019-03-20v4No1 / 592
264amnoncommon oryctolagus cuniculus, rex rabbit, china, caecum, research facility, jiangsu province2017-12-11v4No1 / 622
200amnoncommon in river downstream of wastewater treatment plant (common river, fresh water, water, united states of america, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 752
206amnoncommon in air from israel particles <10um size (common air, dust, israel, size < 10um, clear day)2017-10-04v4No1 / 765
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836

Problems / suggestions? Please email info AT dbbact DOT org