Search result for sequence:
TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCAGTCTTGAGTGCAGTAGAGGTGGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
homo sapiens0.579519
feces0.515789
adult0.425567
united states of america0.214322
china0.156658
control0.142878
child0.140105
city0.118896
israel0.089888
rat0.088889
obsolete_juvenile stage0.083770
jiangsu province0.082051
kingdom of spain0.081218
heterosexual0.077886
msw0.077886
male0.074967
infant0.070850
caecum0.067797
female0.064257
research facility0.064198
rattus norvegicus0.060606
state of california0.058947
czech republic0.054745
rectum0.054496
LOWER IN control0.048338
LOWER IN homosexual0.045455
LOWER IN msm0.045455
rex rabbit0.045198
age 5-13 years0.045198
LOWER IN ulcerative colitis0.044944
india0.044944
oryctolagus cuniculus0.044199
sichuan province0.043716
ileum0.043716
united kingdom0.043716
rural community0.043716
state of colorado0.043243
kingdom of norway0.042781
antibiotic0.041451
colon0.040747
germany0.040609
sprague dawley0.038647
parkinson's disease0.034483
LOWER IN gay0.034286
wistar rat0.034188
gallbladder0.033898
bile0.033898
cholelithiasis0.033898
oslo0.033898
LOWER IN rural community0.033898
LOWER IN child0.033708
water0.033661
south korea0.033613
biopsy0.033333
age 50-80 years0.033333
amsterdam0.033333
LOWER IN crohn's disease0.033333
rattus0.033333
kingdom of denmark0.033058
kingdom of the netherlands0.032787
commonwealth of pennsylvania0.031746
age0.031579
australia0.030303
fresh water0.030075
age 19-240.022989
metabolic syndrome0.022989
mongolian sheep0.022857
age one year0.022857
age 30-400.022857
taiwan0.022857
taipei city0.022857
low anterior resection0.022857
osteoarthritis0.022857
jordan0.022857
quito0.022857
age 13-140.022857
yaounde0.022857
cameroon0.022857
denver0.022857
lima0.022857
shantytown0.022857
age 60-790.022857
age 30-500.022857
age >940.022857
glasgow0.022857
age 130.022857
LOWER IN small village0.022857
age 50-60 years0.022857
nanning city prefecture0.022857
dahl salt-sensitive0.022857
estuary0.022857
estuary water0.022857
salinity <5 ppt0.022857
bilbao0.022857
chuquisaca department0.022857
LOWER IN age &lt; 1 year0.022727
neomycin0.022599
age 2 months0.022599
state of oklahoma0.022599
africa0.022599
Fraction of dbbact annotations with this term covered by the query
TermScore
caecum1.000000
parkinson's disease1.000000
heterosexual0.800000
msw0.800000
LOWER IN homosexual0.800000
LOWER IN msm0.800000
LOWER IN gay0.750000
rex rabbit0.666667
age 5-13 years0.666667
age 19-240.666667
metabolic syndrome0.666667
wistar rat0.666667
LOWER IN ulcerative colitis0.571429
india0.571429
gallbladder0.500000
bile0.500000
cholelithiasis0.500000
mongolian sheep0.500000
cecum0.500000
sigmoid colon0.500000
children0.500000
equine grass sickness0.500000
anorexia nervosa0.500000
age one year0.500000
oslo0.500000
age 30-400.500000
taiwan0.500000
taipei city0.500000
low anterior resection0.500000
osteoarthritis0.500000
insomnia0.500000
jordan0.500000
quito0.500000
age 13-140.500000
LOWER IN endospore enriched fraction0.500000
LOWER IN lysis0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
rectal swab0.500000
athlete0.500000
LOWER IN rural community0.500000
yaounde0.500000
cameroon0.500000
LOWER IN ngoantet0.500000
age 17-290.500000
denver0.500000
type 2 diabetes mellitus0.500000
age 200.500000
metabolic syndrome x0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
aardvark0.500000
orycteropus afer0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
age 60-790.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
age >940.500000
glasgow0.500000
cron diet0.500000
rem sleep behavior disorder0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
age 130.500000
toronto0.500000
LOWER IN plant diet0.500000
dnbs induced colitis0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
low income0.500000
LOWER IN sewer0.500000
LOWER IN wastewater treatment plant0.500000
new delhi0.500000
spondyloarthritis0.500000
spondylitis0.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
atherosclerosis0.500000
poland0.500000
LOWER IN el salado0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
hirundo rustica0.500000
colorado0.500000
barn swallow0.500000
dahl salt-sensitive0.500000
salt rich diet0.500000
salt0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.859649
homo sapiens0.830409
adult0.426901
united states of america0.292398
china0.175439
control0.152047
child0.087719
research facility0.076023
city0.070175
rat0.052632
israel0.052632
LOWER IN control0.046784
kingdom of spain0.046784
female0.046784
obsolete_juvenile stage0.046784
jiangsu province0.046784
male0.040936
infant0.040936
state of california0.040936
heterosexual0.040936
msw0.040936
caecum0.035088
rattus norvegicus0.035088
rectum0.029240
czech republic0.029240
oryctolagus cuniculus0.023392
rex rabbit0.023392
sichuan province0.023392
antibiotic0.023392
ileum0.023392
colon0.023392
sprague dawley0.023392
united kingdom0.023392
kingdom of norway0.023392
age 5-13 years0.023392
LOWER IN ulcerative colitis0.023392
state of colorado0.023392
LOWER IN homosexual0.023392
LOWER IN msm0.023392
germany0.023392
rural community0.023392
india0.023392
water0.023392
gallbladder0.017544
bile0.017544
cholelithiasis0.017544
biopsy0.017544
age 50-80 years0.017544
kingdom of denmark0.017544
australia0.017544
oslo0.017544
parkinson's disease0.017544
south korea0.017544
commonwealth of pennsylvania0.017544
LOWER IN rural community0.017544
amsterdam0.017544
kingdom of the netherlands0.017544
LOWER IN gay0.017544
LOWER IN child0.017544
LOWER IN crohn&#39;s disease0.017544
rattus0.017544
wistar rat0.017544
age0.017544
fresh water0.017544
mongolian sheep0.011696
ovis aries0.011696
left colon0.011696
biopsy site0.011696
ampicillin0.011696
neomycin0.011696
farm0.011696
commonwealth of virginia0.011696
age one year0.011696
age 2 months0.011696
hospital0.011696
diarrhea0.011696
age 30-400.011696
taiwan0.011696
taipei city0.011696
low anterior resection0.011696
brazil0.011696
osteoarthritis0.011696
jordan0.011696
quito0.011696
ecuador0.011696
age 13-140.011696
zoological garden0.011696
LOWER IN hiv infection0.011696
age 19-240.011696
yaounde0.011696
cameroon0.011696
denver0.011696
metabolic syndrome0.011696
pregnancy0.011696
belgium0.011696
lima0.011696
shantytown0.011696
state of oklahoma0.011696
age 60-790.011696
age 30-500.011696
Exp. ID User ID Description Date Region Flag Sequences
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 5
526amnonhigh freq in bile of Cholelithiasis patients (dominant homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 7
111amnondominant mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 13
409amnondominant homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v4No1 / 15
19amnonhigh freq in biopsies of children (IBD study) (dominant rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 16
448amnondominant equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 16
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v4No1 / 16
591amnondominant homo sapiens, feces, adult, age 50-80 years, united states of america, control2020-02-17v4No1 / 17
215amnondominant homo sapiens, feces, united states of america2017-10-23v4No1 / 18
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
273amnondominant feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
284amnondominant homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 20
122amnondominant homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
249amnondominant homo sapiens, feces, united states of america2017-11-22v4No1 / 21
330amnondominant homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 21
390amnondominant homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 21
591amnondominant homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 21
529amnonhigh freq. in patients that underwent low anterior resection (dominant homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 21
120amnondominant homo sapiens, feces, brazil2017-04-12v4No1 / 22
284amnondominant homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
593amnondominant homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 22
394amnondominant homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
566amnon high in insomnia compared to control in homo sapiens feces china adult 2019-11-24v4No1 / 23
330amnondominant homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
365amnondominant homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
562amnondominant feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 28
438amnondominant homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
406amnoncommon feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 47
563amnon high in control compared to hiv infection in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 58
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
575amnoncommon in professional martial arts athletes (common homo sapiens, feces, athlete, high physical activity, adult, china, age 19-24)2020-01-05v3No1 / 63
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v4No1 / 70
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 82
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
629amnon high in heterosexual msw compared to homosexual msm in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 85
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
430amnoncommon homo sapiens, adult, united states of america, state of arizona, city, age 20, feces2018-12-15v4No1 / 87
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
438amnoncommon homo sapiens, feces, age 19-24, china2018-12-30v4No1 / 101
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
438amnoncommon feces, homo sapiens, age 60-79, adult, jiangsu province, china2018-12-30v4No1 / 111
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 188
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in msw heterosexual compared to homosexual gay msm in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 220
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v4No1 / 241
161amnoncommon in barn swallows in colorado (common hirundo rustica, feces, united states of america, colorado, barn swallow)2017-07-12v4No1 / 245
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v4No1 / 287
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 400
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
264amnoncommon oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 622
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
443amnon high in free floating filtered 0.2um compared to particle filtered 2.7um in water river fresh water depth 1m united states of america mississippi river 2019-01-07v4No1 / 755
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org