Search result for sequence:
TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
feces0.696928
homo sapiens0.581244
adult0.422373
united states of america0.348928
mus musculus0.251642
research facility0.249626
mouse0.232514
china0.201101
control0.130219
female0.118534
caecum0.109279
child0.108025
infant0.094340
c57bl/60.091831
city0.081766
rat0.057752
male0.057692
israel0.056172
kingdom of spain0.052980
japan0.052016
state of california0.048485
mouse chow0.047863
colon0.046205
guangzhou city prefecture0.041096
obesity0.041056
state of texas0.040268
obsolete_juvenile stage0.037543
sweden0.037125
diet0.036851
germany0.035796
taiwan0.034642
rattus norvegicus0.034443
ulcerative colitis0.034364
balb/c0.034247
crohn's disease0.034247
australia0.033933
south korea0.033898
diarrhea0.033860
soil0.033849
wild0.033742
united kingdom0.033670
hospital0.032573
heterosexual0.031291
msw0.031291
charles river laboratories0.031250
sprague dawley0.031088
rectum0.030928
kingdom of denmark0.030612
state of colorado0.030457
jiangsu province0.028302
age < 3 years0.027778
c57bl/6j0.027397
human late adulthood stage0.027397
state of new york0.026490
chicken0.026374
gallus gallus0.026258
farm0.025740
rattus0.024458
obese body mass index status0.024419
finland0.024295
high fat diet0.024221
fourth decade human stage0.024221
state of michigan0.024148
ovis aries0.023932
age0.023932
switzerland0.023649
state of florida0.023372
zoological garden0.023372
LOWER IN control0.023001
colombia0.020942
republic of china0.020942
1-year-old human stage0.020833
india0.020833
biopsy0.020761
state of georgia0.020761
12-month-old human stage0.020761
pregnancy0.020747
rural community0.020725
poland0.020619
commonwealth of pennsylvania0.020305
LOWER IN rural community0.017544
age 30 days0.017498
homosexual0.017498
msm0.017498
parkinson's disease0.017472
hangzhou city prefecture0.017422
age 6-14 years0.017422
ecuador0.017422
clostridium difficile intestinal infectious disease0.017422
LOWER IN duodenum0.017422
nanjing county0.017422
chrysanthemum0.017422
chrysanthemum morifolium ramat.0.017422
czech republic0.017371
hispanic or latin american0.017271
kingdom of the netherlands0.017271
ph 6.90.017271
LOWER IN male0.017094
brazil0.016788
dog0.016648
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN rural community0.833333
rattus0.833333
heterosexual0.800000
msw0.800000
LOWER IN small village0.750000
charles river laboratories0.750000
obese body mass index status0.750000
taiwan0.750000
rat0.687500
metabolic syndrome0.666667
mouse chow0.666667
low fat diet0.666667
young adult stage0.666667
colombia0.666667
age < 3 years0.666667
overweight body mass index status0.666667
republic of china0.666667
adolescent stage0.666667
age 5-13 years0.666667
age 30 days0.666667
ninth decade human stage0.666667
homosexual0.666667
msm0.666667
athlete0.666667
state of oklahoma0.666667
central african republic0.666667
wistar rat0.666667
LOWER IN age 1 week0.666667
LOWER IN canis lupus0.666667
LOWER IN wolf0.666667
snake0.666667
c57bl/60.611111
feces0.610390
parkinson's disease0.600000
guangzhou city prefecture0.600000
colitis0.600000
LOWER IN homosexual0.600000
LOWER IN msm0.600000
rattus norvegicus0.600000
sprague dawley0.600000
obesity0.583333
mus musculus0.571429
finland0.571429
LOWER IN under-1-year-old human stage0.571429
ulcerative colitis0.555556
mouse0.553571
homo sapiens0.532319
city0.526316
resistant starch type 4 diet0.500000
metabolic syndrome x0.500000
LOWER IN type 1 diabetes mellitus0.500000
hangzhou city prefecture0.500000
age 6-14 years0.500000
eagle harbor0.500000
sea urchin0.500000
bolivia0.500000
peru0.500000
ants0.500000
tucson0.500000
stress: chronic subordinate colony housing0.500000
LOWER IN no stress: single housed control0.500000
immunization0.500000
immunization mycobacterium vaccae0.500000
c57bc/6ncrl0.500000
ecuador0.500000
younger age0.500000
LOWER IN older age0.500000
lamb0.500000
schizophrenia0.500000
rectum0.500000
children0.500000
clostridium difficile intestinal infectious disease0.500000
high fat diet0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
eucalyptus viminalis diet0.500000
acute severe colitis0.500000
icr/cd-1 mice0.500000
biopsy site0.500000
house mice0.500000
systemic lupus erythematosus0.500000
acute pancreatitis0.500000
pancreatitis0.500000
malaria0.500000
balb/c0.500000
irritable bowel syndrome0.500000
20-year-old human stage0.500000
crohn's disease0.500000
atherosclerosis0.500000
tharu0.500000
agrarian0.500000
LOWER IN forager0.500000
LOWER IN chepang0.500000
himalayas0.500000
daycare0.500000
1-5-years-old human0.500000
type 2 diabetes mellitus0.500000
caribbean latino0.500000
breast fed0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.812057
homo sapiens0.640071
adult0.370567
united states of america0.358156
research facility0.200355
china0.179078
mus musculus0.161348
mouse0.147163
control0.095745
female0.070922
child0.062057
caecum0.062057
infant0.053191
c57bl/60.049645
city0.044326
male0.031915
israel0.030142
rat0.030142
japan0.028369
kingdom of spain0.028369
state of california0.028369
mouse chow0.024823
colon0.024823
soil0.024823
obesity0.021277
guangzhou city prefecture0.021277
state of texas0.021277
diet0.019504
wild0.019504
australia0.019504
sweden0.019504
germany0.019504
obsolete_juvenile stage0.019504
diarrhea0.017730
hospital0.017730
ulcerative colitis0.017730
balb/c0.017730
crohn's disease0.017730
united kingdom0.017730
taiwan0.017730
south korea0.017730
rattus norvegicus0.017730
rectum0.015957
kingdom of denmark0.015957
charles river laboratories0.015957
LOWER IN control0.015957
jiangsu province0.015957
state of colorado0.015957
heterosexual0.015957
msw0.015957
sprague dawley0.015957
c57bl/6j0.014184
human late adulthood stage0.014184
state of new york0.014184
age < 3 years0.014184
gallus gallus0.014184
chicken0.014184
farm0.014184
state of florida0.012411
ovis aries0.012411
state of michigan0.012411
high fat diet0.012411
switzerland0.012411
obese body mass index status0.012411
finland0.012411
fourth decade human stage0.012411
zoological garden0.012411
age0.012411
rattus0.012411
biopsy0.010638
poland0.010638
state of georgia0.010638
rural community0.010638
colombia0.010638
1-year-old human stage0.010638
republic of china0.010638
commonwealth of pennsylvania0.010638
12-month-old human stage0.010638
india0.010638
pregnancy0.010638
hangzhou city prefecture0.008865
age 6-14 years0.008865
hispanic or latin american0.008865
LOWER IN rural community0.008865
ecuador0.008865
parkinson's disease0.008865
clostridium difficile intestinal infectious disease0.008865
brazil0.008865
age 30 days0.008865
LOWER IN duodenum0.008865
LOWER IN male0.008865
homosexual0.008865
msm0.008865
czech republic0.008865
canis lupus familiaris0.008865
dog0.008865
kingdom of the netherlands0.008865
water0.008865
rhizosphere0.008865
nanjing county0.008865
Exp. ID User ID Description Date Region Flag Sequences
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in diet starch diet resistant starch type 4 diet compared to control diet in feces homo sapiens united states of america metabolic syndrome x metabolic syndrome )2019-02-24v4No1 / 6
207amnoncommon in people hospitalized with diarrhea (common feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 7
825amnon high in control compared to type i diabetes mellitus type 1 diabetes mellitus in feces homo sapiens child china hangzhou city prefecture age 6-14 years 2021-08-12v3No1 / 7
351amnoncommon digestive system, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 11
386amnondominant caecum, mus musculus, bolivia, mouse, wild2018-10-28v4No1 / 11
184amnoncommon digestive system, peru, ants, crematogaster2017-08-15v4No1 / 12
689amnoncommon feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 12
644amnondominant feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 13
47amnonsmj: higher in bullied immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america research facility mus musculus male immunization immunization mycobacterium vaccae c57bc/6ncrl )2017-01-13v4No1 / 13
214amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, mouse chow2017-10-23v4No1 / 14
290amnon high in city compared to small village rural community in feces homo sapiens adult china 2018-02-01v4No1 / 14
386amnondominant caecum, mus musculus, ecuador, mouse, wild2018-10-28v4No1 / 14
657amnonnegatively correlated with age ( high in younger age compared to age older age in research facility rumen ovis aries qinghai province rumen liquid age < 1 year sheep lamb china )2020-09-13v4No1 / 14
834amnondominant feces, homo sapiens, adult, japan2021-09-11v1No1 / 14
502amnondominant feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 15
651amnondominant feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 15
651amnondominant feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 15
708amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, mouse, state of montana2028-05-16v4No1 / 15
51amnondominant feces, homo sapiens, united states of america2017-01-19v4No1 / 15
74amnondominant feces, homo sapiens, united states of america2017-02-27v4No1 / 15
19amnonhigh freq in biopsies of children (IBD study) (dominant homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 16
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
214amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, high fat diet, mouse2017-10-23v4No1 / 16
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 16
310amnondominant feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 16
541amnondominant feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 16
659amnondominant feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 16
719amnondominant united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 16
51amnondominant homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 16
289amnondominant feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (dominant united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 17
368amnondominant feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 17
369amnondominant feces, research facility, mus musculus, c57bl/6j, switzerland, mouse, mouse chow2018-09-06v4No1 / 17
386amnondominant caecum, mus musculus, brazil, mouse, wild2018-10-28v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 17
428amnondominant feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 17
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in feces research facility mus musculus balb/c mouse japan )2019-03-12v4No1 / 17
591amnondominant feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 17
663amnondominant feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 17
36amnondominant feces, homo sapiens, sichuan province2016-12-06v4No1 / 18
119amnondominant feces, research facility, mus musculus, sweden, mouse2017-04-12v4No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (dominant feces, homo sapiens, israel, diarrhea)2017-10-05v4No1 / 18
215amnondominant feces, homo sapiens, united states of america2017-10-23v4No1 / 18
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 18
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 18
294amnondominant feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
368amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 18
428amnondominant feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 18
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 18
650amnondominant feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 18
663amnondominant feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 18
713amnondominant feces, homo sapiens, remission, crohn's disease2028-05-21v3No1 / 18
292amnondominant feces, homo sapiens, control, adult, china2018-02-05v4No1 / 19
401amnondominant feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 19
438amnondominant feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 19
438amnondominant feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 19
455amnondominant feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to forager chepang in feces homo sapiens adult nepal himalayas rural community )2019-01-28v4No1 / 19
477amnondominant feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 19
482amnondominant feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 19
503amnondominant feces, research facility, mus musculus, c57bl/6, mouse, japan2019-03-12v4No1 / 19
516amnondominant feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
803amnondominant feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 19
797amnondominant feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 19
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 20
292amnondominant feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 20
390amnondominant feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 20
390amnondominant feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 20
394amnondominant feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 20
476amnondominant feces, united states of america, research facility, mus musculus, state of iowa, mouse, cf-12019-01-28v4No1 / 20
484amnondominant feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 20
650amnondominant feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 20
663amnondominant feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 20
803amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 20
108amnondominant united states of america, research facility, caecum, mus musculus, state of texas, mouse2017-04-07v4No1 / 21
122amnondominant feces, homo sapiens, united kingdom2017-04-13v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant feces, homo sapiens, infant, finland, age < 3 years)2017-11-13v4No1 / 21
249amnondominant feces, homo sapiens, united states of america2017-11-22v4No1 / 21
320amnondominant feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 21
330amnondominant feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 21
390amnondominant feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 21
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 21
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant feces, united states of america, female, research facility, mus musculus, mouse, harlan sprague dawley)2019-01-11v4No1 / 21
503amnondominant feces, research facility, mus musculus, balb/c, mouse, japan2019-03-12v4No1 / 21
591amnondominant feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 21
779amnondominant feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 21
814amnondominant feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 21
529amnonhigh freq. in patients that underwent low anterior resection (dominant feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 21
734amnondominant feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 21
825amnondominant feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 21
835amnondominant feces, homo sapiens, adult, japan2021-09-11v3No1 / 21
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 22
120amnondominant feces, homo sapiens, brazil2017-04-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
219amnonhigh freq. in mother mice feces (dominant feces, female, research facility, mus musculus, c57bl/6, mouse, south korea)2017-10-24v4No1 / 22
284amnondominant feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 22
293amnondominant feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 22
334amnondominant feces, research facility, mus musculus, c57bl/6, israel, mouse2018-05-15v4No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ailurus fulgens, red panda2018-11-16v4No1 / 22
502amnondominant feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 22
650amnondominant feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 22
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 22
10amnondominant feces, homo sapiens, toronto2016-10-27v4No1 / 23
42amnonhigh freq. in tcr-b deficient balb/c mice (dominant feces, research facility, mus musculus, balb/c, japan)2016-12-10v4No1 / 23
132amnondominant feces, homo sapiens, united states of america2017-04-16v4No1 / 23
225amnonhigh freq. in polgA mutants (accelerated aging) (dominant feces, research facility, mus musculus, mouse, polga mutant, united kingdom)2017-10-29v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (dominant feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
394amnondominant feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 23
541amnondominant feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 23
669amnondominant feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 23
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
841amnondominant feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 23
239amnondominant feces, homo sapiens, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common feces, homo sapiens, infant, estonia, age < 3 years)2017-11-13v4No1 / 24
395amnondominant feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 24
447amnondominant united states of america, research facility, caecum, mus musculus, c57bl/6, state of maryland, mouse, charles river laboratories2019-01-08v4No1 / 24
566amnondominant feces, homo sapiens, adult, china2019-11-24v4No1 / 24
683amnondominant feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 24
597amnondominant feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
108amnondominant united states of america, research facility, colon, mus musculus, state of texas, mouse2017-04-07v4No1 / 25
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
290amnondominant feces, homo sapiens, city, adult, china2018-02-01v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
689amnondominant feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 26
802amnondominant feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 26
131amnondominant feces, homo sapiens, south korea2017-04-16v4No1 / 27
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v4No1 / 27
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
529amnondominant feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 27
319amnondominant feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 28
562amnondominant feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 28
825amnondominant feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 28
438amnondominant feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 29
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 30
695amnondominant feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common feces, homo sapiens, infant, india)2016-12-19v4No1 / 31
390amnoncommon feces, homo sapiens, hospital, australia, clostridium difficile intestinal infectious disease, diarrhea2018-11-04v4No1 / 31
108amnoncommon united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in breast milk age age 21 days compared to mouse chow age 28 days in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 36
240amnoncommon in infants age <3 years (common feces, homo sapiens, infant, finland, age < 3 years)2017-11-12v4No1 / 36
407amnon high in dry season compared to wet season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 36
51amnoncommon homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 36
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
390amnoncommon feces, homo sapiens, hospital, australia, diarrhea2018-11-04v4No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v4No1 / 38
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in feces homo sapiens united states of america )2017-02-27v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
835amnoncommon feces, homo sapiens, adult, japan2021-09-11v3No1 / 40
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in feces homo sapiens united states of america adult )2018-11-18v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
831amnoncommon feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 43
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
738amnon high in standard feed compared to high wellfare feed in caecum gallus gallus chicken age 30 days united kingdom 2021-01-30v3No1 / 45
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
830amnoncommon feces, homo sapiens, peru, age 9-17 years, teenager2021-09-10v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
495amnon high in typhlitis disease intestinal disease compared to control in farm caecum gallus gallus kingdom of spain chicken free range chicken 2019-03-03v4No1 / 48
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
834amnoncommon feces, homo sapiens, adult, japan2021-09-11v1No1 / 50
14amnon high in feces caecum transverse colon left colon right colon compared to stomach duodenum jejunum ileum in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 51
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
830amnon high in iga negative fraction iga igg negative fraction compared to iga positive fraction in feces homo sapiens peru age 9-17 years teenager 2021-09-10v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
847amnoncommon feces, japan, 80 year-old and over human stage, ninth decade human stage2021-12-01v1No1 / 52
225amnonhigher in polgA mutants (accelarated aging) compared to wild type ( high in polga mutant compared to wild type genotype in feces research facility mus musculus mouse united kingdom )2017-10-29v4No1 / 53
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
847amnoncommon feces, japan, eleventh decade human stage, centenarian human stage2021-12-01v1No1 / 54
847amnoncommon feces, japan, human early adulthood stage2021-12-01v1No1 / 54
131amnon high in female compared to male in feces homo sapiens south korea 2017-04-16v4No1 / 55
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon feces, homo sapiens, hospital, salmonella gastroenteritis, australia, diarrhea2018-11-04v4No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in feces research facility mus musculus c57bl/6j switzerland mouse mouse chow )2018-09-06v4No1 / 58
563amnon high in control compared to hiv infection in feces homo sapiens united states of america male homosexual msm rectal swab 2019-11-18v4No1 / 58
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
666amnoncommon feces, homo sapiens, italy2020-09-25v3No1 / 58
214amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, mouse chow2017-10-23v4No1 / 60
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
831amnoncommon feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 60
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
51amnon high in control compared to hiv infection in feces homo sapiens united states of america 2017-01-19v4No1 / 62
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in feces united states of america mus musculus mouse )2017-04-14v4No1 / 63
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
630amnon high in female compared to male in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
114amnon high in adult compared to tadpole in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 67
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
22amnon high in control compared to hiv infection in feces homo sapiens united states of america 2016-11-28v4No1 / 70
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
645amnon high in cloaca compared to feces in state of idaho bird captive gymnogyps californianus california condor 2020-09-03v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
656amnoncommon feces, homo sapiens, sri lanka, age 1-18 years, child stage, adolescent stage2020-09-13v3No1 / 71
114amnoncommon united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 72
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
719amnoncommon united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
556amnoncommon feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 77
589amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 78
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
39amnonlower in whole wheat diet compared to normal chow ( high in control normal diet compared to diet whole wheat diet in feces research facility mus musculus obesity )2016-12-09v4No1 / 83
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 83
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours newborn human stage compared to age >= 7 days newborn human stage in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 85
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
494amnon high in diet high fat diet western diet compared to mouse chow in research facility colon mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 85
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
629amnon high in heterosexual msw compared to homosexual msm in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
804amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 85
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 86
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
404amnon high in female compared to male in feces homo sapiens city adult colombia 2018-11-20v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 89
386amnoncommon caecum, mus musculus, ecuador, mouse, wild2018-10-28v4No1 / 90
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in united states of america research facility caecum mus musculus c57bl/6 state of maryland mouse charles river laboratories )2019-01-08v4No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
238amnoncommon feces, homo sapiens, colombia2017-11-07v4No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
645amnoncommon cloaca, state of idaho, bird, captive, gymnogyps californianus, california condor2020-09-03v4No1 / 99
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
740amnoncommon cloaca, ecuador, galapagos islands, alimentary part of gastrointestinal system, amblyrhynchus cristatus, cloacal swab, marine iguana2021-02-08v4No1 / 110
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
220amnon high in diet low fat diet mouse chow compared to high fat diet in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
449amnoncommon feces, homo sapiens, colombia2019-01-09v4No1 / 124
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
131amnoncommon feces, homo sapiens, south korea2017-04-16v4No1 / 128
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
386amnoncommon caecum, mus musculus, bolivia, mouse, wild2018-10-28v4No1 / 129
841amnoncommon homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 129
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 141
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in feces united states of america research facility mus musculus obese body mass index status mouse db/db mouse obesity )2017-10-22v4No1 / 143
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult fourth decade human stage compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
611amnoncommon research facility, caecum, mus musculus, mouse, cecal content, canada, age 9 months2020-04-21v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
300amnoncommon united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 150
589amnoncommon feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 151
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 151
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
833amnoncommon feces, homo sapiens, adult, slovak republic, age 60-65 years, normal exercise2021-09-11v1No1 / 154
833amnoncommon feces, homo sapiens, adult, slovak republic, athlete, age 60-65 years, high exercise2021-09-11v1No1 / 154
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease late timepoints trichuris muris in feces research facility mus musculus sweden mouse )2017-04-12v4No1 / 155
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
108amnoncommon united states of america, research facility, colon, mus musculus, state of texas, mouse2017-04-07v4No1 / 158
494amnoncommon research facility, colon, mus musculus, high fat diet, c57bl/6, male, sweden, mouse, western diet, charles river laboratories2019-02-27v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 163
337amnoncommon in feces of house mice from new york city (common united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 165
456amnoncommon united states of america, female, research facility, caecum, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 167
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
457amnoncommon feces, research facility, mus musculus, male, finland, mouse, c57bl/6ncrl, high fat diet + polydextrose, polydextrose2019-01-11v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
123amnon high in diet high fat diet compared to normal diet mouse chow in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 170
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 170
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 183
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
458amnoncommon in mice strains from harlan sprague dawley (common feces, united states of america, female, research facility, mus musculus, mouse, harlan sprague dawley)2019-01-11v4No1 / 184
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v4No1 / 187
326amnon high in diet mouse chow compared to high fat diet in united states of america research facility mus musculus c57bl/6 state of washington mouse ldlr- 2018-04-29v4No1 / 189
386amnoncommon caecum, mus musculus, brazil, mouse, wild2018-10-28v4No1 / 189
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
334amnoncommon feces, research facility, mus musculus, c57bl/6, israel, mouse2018-05-15v4No1 / 200
6amnoncommon homo sapiens, urine, female, pregnancy, state of tennessee2016-10-13v4No1 / 201
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
738amnoncommon caecum, gallus gallus, chicken, age 30 days, united kingdom2021-01-30v3No1 / 202
248amnoncommon feces, research facility, mus musculus, germany, mouse, fvb/n mice2017-11-22v4No1 / 203
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
457amnoncommon feces, research facility, mus musculus, high fat diet, male, finland, mouse, c57bl/6ncrl2019-01-11v4No1 / 204
568amnon high in thailand compared to viet nam in feces gallus gallus chicken broiler chicken 2019-12-08v3No1 / 206
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
503amnoncommon feces, research facility, mus musculus, c57bl/6, mouse, japan2019-03-12v4No1 / 210
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila drosophila nigrospiracula fly compared to cactus decaying in desert mexico )2017-10-01v4No1 / 215
108amnoncommon united states of america, research facility, caecum, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 216
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
369amnoncommon feces, research facility, mus musculus, c57bl/6j, switzerland, mouse, mouse chow2018-09-06v4No1 / 224
42amnoncommon in tcr-b deficient balb/c mice (common feces, research facility, mus musculus, balb/c, japan)2016-12-10v4No1 / 227
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
708amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, mouse, state of montana2028-05-16v4No1 / 232
351amnoncommon feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 233
349amnoncommon feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 235
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in soldiers young adult stage compared to adult age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 238
119amnoncommon feces, research facility, mus musculus, sweden, mouse2017-04-12v4No1 / 239
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
108amnoncommon united states of america, research facility, caecum, mus musculus, state of texas, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 241
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 241
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common feces, female, research facility, mus musculus, c57bl/6, mouse, south korea)2017-10-24v4No1 / 250
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 254
503amnoncommon feces, research facility, mus musculus, balb/c, mouse, japan2019-03-12v4No1 / 257
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
494amnoncommon research facility, colon, mus musculus, c57bl/6, male, sweden, mouse, mouse chow, charles river laboratories2019-02-27v4No1 / 275
225amnoncommon in polgA mutants (accelerated aging) (common feces, research facility, mus musculus, mouse, polga mutant, united kingdom)2017-10-29v4No1 / 281
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in feces research facility mus musculus israel mouse )2018-05-15v4No1 / 284
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 287
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, age 6 weeks, free range chicken2019-03-03v4No1 / 290
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
708amnonlower in mice with iron deficient diet ( high in iron iron supplemented diet compared to iron deficient diet low iron in feces united states of america research facility mus musculus c57bl/6 mouse state of montana )2028-05-16v4No1 / 295
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v4No1 / 296
476amnoncommon feces, united states of america, research facility, mus musculus, state of iowa, mouse, cf-12019-01-28v4No1 / 297
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
78amnon high in male compared to female in feces tropical grassland biome kenya nanger granti gazelle 2017-03-01v4No1 / 301
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 309
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces state of florida central america alouatta palliata mantled howler monkey 2017-03-03v4No1 / 314
13amnon high in feces rectum caecum colon compared to stomach esophagus duodenum ileum mouth in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 316
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in feces united states of america bos taurus state of georgia cow post-weaning angus steer )2019-06-11v4No1 / 325
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 327
447amnoncommon united states of america, research facility, caecum, mus musculus, fasting, c57bl/6, state of maryland, mouse, charles river laboratories, every other day fasting2019-01-08v4No1 / 328
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
710amnon high in feces compared to stomach small intestine in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 329
111amnoncommon rectum, caecum, colon, ileum, ovis aries, mongolian sheep, china2017-04-09v4No1 / 330
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
456amnon high in caecum compared to tongue in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 338
124amnoncommon feces, united states of america, caecum, mus musculus, c57bl/6j, mouse2017-04-14v4No1 / 339
190amnon high in wet season compared to dry season in feces homo sapiens tanzania hunter gatherer hadza 2017-09-04v4No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
447amnoncommon united states of america, research facility, caecum, mus musculus, c57bl/6, state of maryland, mouse, charles river laboratories2019-01-08v4No1 / 343
187amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2017-08-23v4No1 / 351
792amnoncommon desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, nitraria tangutorum, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 352
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
225amnoncommon in wild type cotrols (common feces, research facility, mus musculus, wild type genotype, mouse, united kingdom)2017-10-29v4No1 / 370
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
216amnoncommon feces, research facility, mus musculus, c57bl/6, male, mouse, china2017-10-24v4No1 / 385
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
792amnon high in soil compared to rhizosphere haloxylon ammodendron nitraria tangutorum in desert depth (soil) 50cm china minqin county sand ph 9 depth (soil) 20-60cm 2021-06-07v4No1 / 432
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v4No1 / 457
111amnon high in rectum caecum colon ileum compared to ruminant reticulum omasum rumen in ovis aries mongolian sheep china 2017-04-09v4No1 / 464
80amnon high in tropical moist broadleaf forest biome compared to dry forest in feces state of florida central america alouatta pigra howler monkey 2017-03-03v4No1 / 465
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470
738amnon high in age 30 days compared to age 1 week in caecum gallus gallus chicken united kingdom 2021-01-30v3No1 / 474
214amnon high in diet mouse chow nih 31m chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 495
657amnoncommon research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 517
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, saint louis, saint louis zoo2020-05-06v4No1 / 530
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
399amnoncommon feces, united states of america, research facility, oryctolagus cuniculus, rabbit2018-11-16v4No1 / 577
372amnon high in mouse chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 579
536amnon high in terrestrial snake compared to aquatic snake in united states of america skin snake southern united states 2019-07-28v4No1 / 590
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
792amnoncommon desert, soil, depth (soil) 50cm, china, minqin county, sand, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 595
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 644
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
25amnoncommon research facility, caecum, oryctolagus cuniculus, rex rabbit, sichuan province2016-12-01v4No1 / 669
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
443amnon high in free floating filtered 0.2um compared to particles filtered 2.7um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v4No1 / 755
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780
478amnoncommon farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 795
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to ulcer wound in homo sapiens skin foot australia diabetes mellitus )2017-11-05v4No1 / 836
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet)2021-04-14v4No1 / 875
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, fusarium oxysporum f. sp. chrysanthemi)2021-04-14v4No1 / 922
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
145amnoncommon united states of america, soil, rhizosphere, oryza sativa, rice, ph 5.62017-04-19v4No1 / 1515
137amnoncommon feces, united states of america, state of florida, gopherus polyphemus, gopher tortoise2017-04-17v4No1 / 1622
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3936
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596

Problems / suggestions? Please email info AT dbbact DOT org