Search result for sequence:
TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
feces0.695346
homo sapiens0.587011
adult0.426168
united states of america0.347241
research facility0.245454
mus musculus0.243705
mouse0.225136
china0.198137
control0.130902
female0.117446
caecum0.108159
child0.102601
infant0.102273
c57bl/60.098655
city0.078078
state of california0.064111
male0.056022
kingdom of spain0.054878
rat0.052975
israel0.051886
japan0.047876
human adult stage0.043900
mouse chow0.043733
colon0.042424
guangzhou city prefecture0.037855
rectum0.037736
obesity0.037719
ulcerative colitis0.037500
state of texas0.037152
obsolete_juvenile stage0.034591
sweden0.033888
diet0.033365
germany0.032145
taiwan0.031881
fourth decade human stage0.031746
hispanic or latin american0.031546
balb/c0.031546
kingdom of denmark0.031422
crohn's disease0.031381
rattus norvegicus0.031381
soil0.031222
south korea0.031153
diarrhea0.031056
wild0.031015
australia0.030856
hospital0.030120
united kingdom0.029674
farm0.029600
msw0.028788
heterosexual0.028788
charles river laboratories0.028754
sprague dawley0.028617
biopsy0.028481
rural community0.028414
state of colorado0.028081
LOWER IN control0.027671
state of florida0.027502
colitis0.027037
age < 3 years0.025559
c57bl/6j0.025157
commonwealth of pennsylvania0.024974
italy0.024870
jiangsu province0.024624
human late adulthood stage0.024169
chicken0.024169
gallus gallus0.024072
state of new york0.024024
obese body mass index status0.022460
finland0.022355
high fat diet0.022293
pregnancy0.022252
state of michigan0.022169
1-month-old human stage0.022047
age0.022047
ovis aries0.021987
rattus0.021950
1-year-old human stage0.021902
human early adulthood stage0.021748
switzerland0.021689
zoological garden0.021572
republic of china0.019262
colombia0.019215
india0.019169
oryctolagus cuniculus0.019169
LOWER IN rural community0.019139
12-month-old human stage0.019108
state of georgia0.019048
kingdom of the netherlands0.019048
adult organism0.018293
poland0.018209
age 30 days0.016090
msm0.016090
homosexual0.016090
parkinson's disease0.016069
age 6-14 years0.016026
hangzhou city prefecture0.016026
breast fed0.016026
los angeles district0.016026
clostridium difficile intestinal infectious disease0.016026
chrysanthemum morifolium ramat.0.016026
Fraction of dbbact annotations with this term covered by the query
TermScore
punta licosa1.000000
lizard1.000000
podarcis siculus1.000000
LOWER IN licosa island1.000000
LOWER IN farm11.000000
farm21.000000
msw0.800000
heterosexual0.800000
LOWER IN small village0.750000
charles river laboratories0.750000
obese body mass index status0.750000
taiwan0.750000
rabbit0.750000
metabolic syndrome0.666667
low fat diet0.666667
salmonella gastroenteritis0.666667
age < 3 years0.666667
overweight body mass index status0.666667
republic of china0.666667
age 5-13 years0.666667
age 30 days0.666667
ninth decade human stage0.666667
msm0.666667
homosexual0.666667
athlete0.666667
state of oklahoma0.666667
urban community0.666667
central african republic0.666667
wistar rat0.666667
snake0.666667
bangladesh0.666667
fourth decade human stage0.625000
rat0.611111
feces0.605797
c57bl/60.600000
parkinson's disease0.600000
guangzhou city prefecture0.600000
sprague dawley0.600000
colombia0.571429
finland0.571429
mus musculus0.552239
rectum0.545455
homo sapiens0.543253
obesity0.538462
mouse chow0.533333
mouse0.524590
metabolic syndrome x0.500000
resistant starch type 4 diet0.500000
LOWER IN type 1 diabetes mellitus0.500000
age 6-14 years0.500000
hangzhou city prefecture0.500000
sea urchin0.500000
eagle harbor0.500000
bolivia0.500000
ants0.500000
adult0.500000
tucson0.500000
hispanic or latin american0.500000
breast fed0.500000
los angeles district0.500000
restraint stress0.500000
c57bc/6ncrl0.500000
immunization0.500000
immunization mycobacterium vaccae0.500000
stress: chronic subordinate colony housing0.500000
LOWER IN no stress: single housed control0.500000
city0.500000
lamb0.500000
schizophrenia0.500000
biopsy0.500000
children0.500000
clostridium difficile intestinal infectious disease0.500000
high fat diet0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
eucalyptus viminalis diet0.500000
acute severe colitis0.500000
icr/cd-1 mice0.500000
antibiotics induced colitis0.500000
biopsy site0.500000
house mice0.500000
systemic lupus erythematosus0.500000
pancreatitis0.500000
acute pancreatitis0.500000
balb/c0.500000
malaria0.500000
20-year-old human stage0.500000
atherosclerosis0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
LOWER IN chepang0.500000
daycare0.500000
1-5-years-old human0.500000
type 2 diabetes mellitus0.500000
caribbean latino0.500000
age one week0.500000
sixth decade human stage0.500000
nanning city prefecture0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.815961
homo sapiens0.638436
adult0.371336
united states of america0.355049
research facility0.198697
china0.179153
mus musculus0.156352
mouse0.143322
control0.096091
female0.070033
caecum0.061889
child0.058632
infant0.058632
c57bl/60.053746
city0.042345
state of california0.037459
male0.030945
kingdom of spain0.029316
israel0.027687
rat0.027687
japan0.026059
human adult stage0.024430
mouse chow0.022801
colon0.022801
soil0.022801
rectum0.019544
ulcerative colitis0.019544
LOWER IN control0.019544
obesity0.019544
guangzhou city prefecture0.019544
state of texas0.019544
diet0.017915
wild0.017915
australia0.017915
sweden0.017915
germany0.017915
obsolete_juvenile stage0.017915
diarrhea0.016287
hospital0.016287
hispanic or latin american0.016287
kingdom of denmark0.016287
balb/c0.016287
crohn's disease0.016287
united kingdom0.016287
fourth decade human stage0.016287
taiwan0.016287
south korea0.016287
farm0.016287
rattus norvegicus0.016287
state of florida0.014658
biopsy0.014658
charles river laboratories0.014658
colitis0.014658
jiangsu province0.014658
rural community0.014658
state of colorado0.014658
msw0.014658
heterosexual0.014658
sprague dawley0.014658
c57bl/6j0.013029
human late adulthood stage0.013029
state of new york0.013029
age < 3 years0.013029
commonwealth of pennsylvania0.013029
chicken0.013029
gallus gallus0.013029
italy0.013029
1-month-old human stage0.011401
ovis aries0.011401
state of michigan0.011401
high fat diet0.011401
switzerland0.011401
human early adulthood stage0.011401
1-year-old human stage0.011401
obese body mass index status0.011401
finland0.011401
zoological garden0.011401
age0.011401
pregnancy0.011401
rattus0.011401
LOWER IN rural community0.009772
poland0.009772
state of georgia0.009772
adult organism0.009772
colombia0.009772
republic of china0.009772
12-month-old human stage0.009772
india0.009772
oryctolagus cuniculus0.009772
kingdom of the netherlands0.009772
age 6-14 years0.008143
hangzhou city prefecture0.008143
breast fed0.008143
hispanic0.008143
los angeles district0.008143
state of illinois0.008143
ecuador0.008143
parkinson's disease0.008143
clostridium difficile intestinal infectious disease0.008143
horse0.008143
Exp. ID User ID Description Date Region Flag Sequences
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in resistant starch type 4 diet starch diet diet compared to control diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 6
207amnoncommon in people hospitalized with diarrhea (common homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 7
825amnon high in control compared to type 1 diabetes mellitus type i diabetes mellitus in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v3No1 / 7
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, digestive system2018-07-30v4No1 / 11
386amnondominant mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 11
184amnoncommon peru, digestive system, ants, crematogaster2017-08-15v4No1 / 12
689amnoncommon non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 12
644amnondominant adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 13
859amnoncommon breast fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 13
866amnondominant restraint stress, mouse, state of illinois, stress, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 13
47amnonsmj: higher in bullied immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 13
214amnondominant mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v4No1 / 14
290amnon high in city compared to rural community small village in homo sapiens feces adult china 2018-02-01v4No1 / 14
386amnondominant mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 14
657amnonnegatively correlated with age ( high in younger age compared to age older age in research facility china qinghai province rumen liquid rumen age < 1 year lamb sheep ovis aries )2020-09-13v4No1 / 14
834amnondominant homo sapiens, feces, japan, adult2021-09-11v1No1 / 14
502amnondominant homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 15
651amnondominant control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
651amnondominant parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
708amnondominant c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v4No1 / 15
51amnondominant feces, homo sapiens, united states of america2017-01-19v4No1 / 15
74amnondominant united states of america, feces, homo sapiens2017-02-27v4No1 / 15
19amnonhigh freq in biopsies of children (IBD study) (dominant rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 16
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
214amnondominant mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 16
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 16
310amnondominant homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 16
541amnondominant phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 16
659amnondominant ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 16
719amnondominant charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v4No1 / 16
884amnondominant human adult stage, state of california, adult, united states of america, homo sapiens, feces2022-03-24v4No1 / 16
902amnondominant antibiotics induced colitis, colitis, adult organism, horse, equus caballus, antibiotic, colitis, united states of america, feces2022-05-02v4No1 / 16
51amnondominant homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 16
289amnondominant homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (dominant mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 17
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
369amnondominant mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 17
386amnondominant mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 17
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 17
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 17
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 17
663amnondominant low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 17
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 17
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 17
36amnondominant homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
119amnondominant mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (dominant homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
215amnondominant homo sapiens, feces, united states of america2017-10-23v4No1 / 18
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 18
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 18
294amnondominant homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 18
430amnondominant 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v4No1 / 18
650amnondominant asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 18
663amnondominant poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 18
713amnondominant remission, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 18
885amnondominant human early adulthood stage, state of florida, united states of america, homo sapiens, feces2022-03-26v3No1 / 18
292amnondominant homo sapiens, adult, feces, control, china2018-02-05v4No1 / 19
401amnondominant homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 19
438amnondominant young adult stage, homo sapiens, feces, china2018-12-30v4No1 / 19
438amnondominant 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 19
455amnondominant homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to chepang forager in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 19
477amnondominant homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 19
482amnondominant homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 19
503amnondominant mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 19
516amnondominant homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 19
689amnoncommon clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 19
803amnondominant human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 19
797amnondominant 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v3No1 / 19
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnondominant 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 20
292amnondominant homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 20
394amnondominant homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
476amnondominant mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 20
484amnondominant feces, adult, 17-29-years-old human, united states of america, state of michigan, homo sapiens2019-02-13v4No1 / 20
650amnondominant state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 20
663amnondominant obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 20
803amnondominant human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 20
108amnondominant state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 21
122amnondominant homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 21
249amnondominant homo sapiens, feces, united states of america2017-11-22v4No1 / 21
320amnondominant homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
330amnondominant fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v4No1 / 21
390amnondominant homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 21
393amnondominant homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 21
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 21
503amnondominant mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 21
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 21
779amnondominant crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 21
814amnondominant high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 21
877amnondominant human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v4No1 / 21
529amnonhigh freq. in patients that underwent low anterior resection (dominant homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 21
734amnondominant omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 21
825amnondominant age 6-14 years, hangzhou city prefecture, china, child, control, homo sapiens, feces2021-08-12v3No1 / 21
835amnondominant feces, homo sapiens, japan, adult2021-09-11v3No1 / 21
928amnondominant human early adulthood stage, kuwait, adult, homo sapiens, feces2022-08-16v3No1 / 21
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
120amnondominant homo sapiens, feces, brazil2017-04-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
219amnonhigh freq. in mother mice feces (dominant mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 22
284amnondominant homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 22
293amnondominant homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
297amnondominant adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
334amnondominant mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 22
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 22
502amnondominant homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
650amnondominant african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 22
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 22
779amnoncommon crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
779amnondominant control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v4No1 / 22
10amnondominant homo sapiens, feces, toronto2016-10-27v4No1 / 23
42amnonhigh freq. in tcr-b deficient balb/c mice (dominant mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 23
132amnondominant homo sapiens, feces, united states of america2017-04-16v4No1 / 23
225amnonhigh freq. in polgA mutants (accelerated aging) (dominant mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 23
284amnondominant 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (dominant homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
394amnondominant homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
541amnondominant phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 23
669amnondominant 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 23
779amnondominant ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 23
841amnondominant human adult stage, state of texas, adult, united states of america, homo sapiens, feces2021-11-08v4No1 / 23
856amnondominant human adult stage, china, intestinal mucosa, biopsy, adult, rectum, control, homo sapiens2022-01-09v3No1 / 23
239amnondominant homo sapiens, feces, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
447amnondominant mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v4No1 / 24
566amnondominant feces, china, homo sapiens, adult2019-11-24v4No1 / 24
683amnondominant state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 24
597amnondominant homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 24
745amnondominant adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 24
108amnondominant state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 25
284amnoncommon 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 25
290amnondominant homo sapiens, feces, adult, city, china2018-02-01v4No1 / 25
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
779amnoncommon ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 25
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 25
689amnondominant non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 26
802amnondominant feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 26
131amnondominant homo sapiens, feces, south korea2017-04-16v4No1 / 27
601amnondominant homo sapiens, feces, china, adult, control2020-03-30v4No1 / 27
659amnoncommon ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 27
529amnondominant homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 27
319amnondominant homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 28
562amnondominant feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 28
825amnondominant type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 28
438amnondominant 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
284amnoncommon 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
438amnondominant 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
695amnondominant sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
856amnoncommon ulcerative colitis, ulcerative colitis, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v3No1 / 33
866amnon high in iga positive fraction compared to iga negative fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 34
108amnoncommon state of texas, research facility, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 35
669amnoncommon 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 35
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
407amnon high in dry season compared to wet season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 36
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v4No1 / 36
233amnon high in 1-year-old human stage age compared to under-1-year-old human stage in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
681amnoncommon seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 37
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 38
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v3No1 / 40
835amnoncommon adult, japan, homo sapiens, feces2021-09-11v3No1 / 40
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
825amnoncommon type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 41
831amnoncommon pancreatic cancer, homo sapiens, feces, adult, israel2021-09-11v3No1 / 43
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
866amnon high in restraint stress stress compared to control in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 44
797amnon high in age 7 months compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 44
738amnon high in standard feed compared to high wellfare feed in caecum age 30 days united kingdom chicken gallus gallus 2021-01-30v3No1 / 45
273amnoncommon 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 46
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 47
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 47
779amnoncommon control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 47
830amnoncommon peru, teenager, age 9-17 years, feces, homo sapiens2021-09-10v4No1 / 47
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 47
495amnon high in typhlitis disease intestinal disease compared to control in gallus gallus chicken caecum kingdom of spain farm free range chicken 2019-03-03v4No1 / 48
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 48
856amnoncommon control, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v3No1 / 48
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 49
797amnoncommon 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v3No1 / 50
849amnoncommon zhejiang province, fourth decade human stage, adult, multiple sclerosis, multiple sclerosis, china, homo sapiens, feces2021-12-14v3No1 / 50
834amnoncommon adult, japan, feces, homo sapiens2021-09-11v1No1 / 50
14amnon high in caecum right colon transverse colon left colon feces compared to stomach duodenum jejunum ileum in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 51
796amnoncommon control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 51
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 52
830amnon high in iga igg negative fraction iga negative fraction compared to iga positive fraction in peru teenager age 9-17 years feces homo sapiens 2021-09-10v4No1 / 52
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 52
796amnoncommon graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 52
867amnoncommon gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 52
847amnoncommon ninth decade human stage, 80 year-old and over human stage, japan, feces2021-12-01v1No1 / 52
225amnonhigher in polgA mutants (accelarated aging) compared to wild type ( high in polga mutant compared to wild type genotype in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 53
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
847amnoncommon eleventh decade human stage, centenarian human stage, japan, feces2021-12-01v1No1 / 54
847amnoncommon human early adulthood stage, japan, feces2021-12-01v1No1 / 54
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
814amnoncommon high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 55
707amnoncommon fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 55
745amnoncommon adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 56
650amnoncommon state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 56
911amnon high in control compared to spinal cord injury in human adult stage nanjing city prefecture china homo sapiens feces 2022-05-21v4No1 / 56
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
928amnoncommon human early adulthood stage, adult, kuwait, feces, homo sapiens2022-08-16v3No1 / 56
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 58
563amnon high in control compared to hiv infection in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 58
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 58
666amnoncommon homo sapiens, italy, feces2020-09-25v3No1 / 58
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v4No1 / 60
734amnoncommon vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 60
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v3No1 / 60
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
849amnoncommon control, fourth decade human stage, china, zhejiang province, adult, homo sapiens, feces2021-12-14v3No1 / 61
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 62
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
851amnoncommon feces, milan, italy, adult, homo sapiens2021-12-16v3No1 / 62
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in mus musculus mouse feces united states of america )2017-04-14v4No1 / 63
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
575amnoncommon in professional martial arts athletes (common young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v3No1 / 63
630amnon high in female compared to male in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
895amnoncommon 6-12 year-old child stage, cystic fibrosis, bordeaux, french republic, child, feces, homo sapiens2022-04-16v4No1 / 65
650amnoncommon asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 66
734amnoncommon coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 66
114amnon high in adult compared to tadpole in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 67
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
902amnoncommon antibiotics induced colitis, antibiotic, colitis, colitis, adult organism, horse, equus caballus, united states of america, feces2022-05-02v4No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 68
644amnon high in female compared to male in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v4No1 / 70
803amnoncommon human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
644amnoncommon adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 71
645amnon high in cloaca compared to feces in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v4No1 / 71
663amnoncommon obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 71
656amnoncommon child stage, adolescent stage, age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 71
870amnoncommon auckland city, fourth decade human stage, third decade human stage, adult, new zealand, homo sapiens, feces2022-02-18v3No1 / 71
114amnoncommon rana pipiens, northern leopard frog, adult, research facility, digesta, intestine, state of wisconsin, united states of america2017-04-10v4No1 / 72
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
861amnoncommon urban community, city, soweto, rural community, south africa, female, homo sapiens, feces2022-01-15v3No1 / 73
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
719amnoncommon charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v4No1 / 75
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in 2-5 year-old child stage age 3-6 compared to 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, 17-29-years-old human, homo sapiens2019-02-13v4No1 / 76
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 77
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 78
596amnon high in under-1-year-old human stage compared to 2-5 year-old child stage age 1-7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 78
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
880amnoncommon kingdom of denmark, human adult stage, adult, feces, homo sapiens2022-03-12v3No1 / 79
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 80
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 82
707amnoncommon fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 82
853amnoncommon age 3 weeks, exclusive breastmilk diet, hyplus rabbit, juvenile, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-18v3No1 / 82
39amnonlower in whole wheat diet compared to normal chow ( high in normal diet control compared to diet whole wheat diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 83
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
663amnoncommon lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 85
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in newborn human stage age age <=24 hours compared to newborn human stage age >= 7 days in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v4No1 / 85
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
494amnon high in diet western diet high fat diet compared to mouse chow in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 85
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
629amnon high in heterosexual msw compared to homosexual msm in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 85
663amnoncommon low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 85
804amnon high in iga negative fraction compared to iga positive fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v4No1 / 85
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
841amnoncommon feces, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v4No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v4No1 / 87
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
884amnoncommon state of california, united states of america, human adult stage, adult, feces, homo sapiens2022-03-24v4No1 / 88
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
803amnoncommon human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 89
386amnoncommon mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 90
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v4No1 / 92
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 98
645amnoncommon cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 99
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
438amnoncommon young adult stage, homo sapiens, feces, china2018-12-30v4No1 / 101
877amnoncommon human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v4No1 / 102
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
797amnon high in 12-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 106
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
802amnoncommon feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
740amnoncommon marine iguana, amblyrhynchus cristatus, ecuador, galapagos islands, cloacal swab, alimentary part of gastrointestinal system, cloaca2021-02-08v4No1 / 110
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
438amnoncommon 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 111
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 112
873amnoncommon urban community, commonwealth of pennsylvania, united states of america, human adult stage, adult, homo sapiens, feces2022-03-03v1No1 / 112
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
861amnoncommon peri-urban community, rural community, bushbuckridge local municipality, human middle aged stage, south africa, female, homo sapiens, feces2022-01-15v3No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v4No1 / 115
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in 3-month-old human stage age compared to 1-month-old human stage age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v4No1 / 116
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
438amnoncommon tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
753amnon high in farm dog breeding center canis lupus familiaris dog compared to captive zoological garden canis lupus wolf in china adult feces 2021-03-12v4No1 / 127
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
386amnoncommon mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 129
841amnoncommon saliva, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v4No1 / 129
330amnoncommon fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v4No1 / 130
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 133
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
197amnoncommon 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, finland2017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
710amnoncommon ketogenic diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 141
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 143
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in fourth decade human stage adult compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
611amnoncommon caecum, mouse, mus musculus, canada, research facility, age 9 months, cecal content2020-04-21v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 147
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in state of minnesota united states of america feces 2021-04-06v4No1 / 148
300amnoncommon rat, rattus norvegicus, caecum, female, ovariectomy, age 38 weeks, united states of america, research facility2018-02-27v4No1 / 150
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 151
710amnoncommon mouse chow, control diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 151
866amnoncommon restraint stress, stress, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 152
885amnoncommon human early adulthood stage, state of florida, united states of america, feces, homo sapiens2022-03-26v3No1 / 152
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
833amnoncommon normal exercise, adult, slovak republic, age 60-65 years, feces, homo sapiens2021-09-11v1No1 / 154
833amnoncommon homo sapiens, feces, age 60-65 years, slovak republic, adult, athlete, high exercise2021-09-11v1No1 / 154
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 155
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
108amnoncommon state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 158
902amnoncommon salmonella gastroenteritis, salmonellosis, adult organism, horse, equus caballus, antibiotic, united states of america, feces2022-05-02v4No1 / 158
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
25amnon high in control compared to antibiotic in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 163
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
906amnoncommon feces, sciurus carolinensis, grey squirrel, province of ontario, canada2022-05-19v4No1 / 165
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 167
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
197amnoncommon 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, india2017-09-12v4No1 / 170
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 172
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 184
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 187
326amnon high in diet mouse chow compared to high fat diet in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v4No1 / 189
386amnoncommon mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 189
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 8 weeks2019-03-03v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
860amnoncommon china, research facility, duck, anas platyrhynchos, intestine, intestinal contents2022-01-12v3No1 / 190
866amnoncommon control, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 193
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
738amnoncommon caecum, age 30 days, united kingdom, chicken, gallus gallus2021-01-30v3No1 / 202
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
438amnonlower in centenarians compared to adults ( high in fifth decade human stage fourth decade human stage 65-79 year-old human stage compared to tenth decade human stage ninth decade human stage age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
568amnon high in thailand compared to viet nam in gallus gallus chicken feces broiler chicken 2019-12-08v3No1 / 206
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 210
669amnon high in 12-month-old human stage compared to 2-month-old human stage in sweden infant feces homo sapiens 2020-09-26v4No1 / 212
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
108amnoncommon quail, state of texas, research facility, united states of america, caecum, coturnix coturnix2017-04-07v4No1 / 216
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 224
902amnon high in salmonella gastroenteritis salmonellosis compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 226
873amnon high in botswana compared to tanzania in africa rural community human adult stage adult homo sapiens feces 2022-03-03v1No1 / 226
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
873amnon high in urban community commonwealth of pennsylvania united states of america compared to tanzania botswana africa rural community in human adult stage adult feces homo sapiens 2022-03-03v1No1 / 227
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
708amnoncommon c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v4No1 / 232
871amnonhigher before antibiotic treatment compared to after treatment ( high in before antibiotics compared to vancomycin antibiotic in human adult stage amsterdam kingdom of the netherlands feces male homo sapiens adult )2022-02-19v3No1 / 232
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 233
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in young adult stage soldiers compared to tenth decade human stage ninth decade human stage fifth decade human stage fourth decade human stage 65-79 year-old human stage adult age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
286amnoncommon in feces of individuals with kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
108amnoncommon state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v4No1 / 241
161amnoncommon in barn swallows in colorado (common state of colorado, hirundo rustica, feces, united states of america, barn swallow)2017-07-12v4No1 / 245
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
45amnonlower in young babies compared to 2 year olds in india ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant india )2016-12-19v4No1 / 253
419amnoncommon rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 254
503amnoncommon mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 257
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
286amnoncommon in feces of individuals without kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 281
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 284
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v4No1 / 287
495amnoncommon gallus gallus, chicken, caecum, kingdom of spain, farm, free range chicken, age 6 weeks2019-03-03v4No1 / 290
863amnoncommon farm, yuzhong county, xinglong mountain national nature reserve, moschus chrysogaster, alpine musk deer, china, deer, captive, feces2022-01-28v4No1 / 290
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
708amnonlower in mice with iron deficient diet ( high in iron supplemented diet iron compared to low iron iron deficient diet in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v4No1 / 295
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 297
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 300
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 301
927amnoncommon punta licosa, lizard, podarcis siculus, italy, feces2022-08-15v3No1 / 305
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
13amnon high in caecum colon rectum feces compared to esophagus stomach duodenum ileum mouth in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 316
510amnoncommon kingdom of spain, water, estuary, estuary water, fresh water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
568amnoncommon gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 320
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in bos taurus cow feces united states of america state of georgia post-weaning angus steer )2019-06-11v4No1 / 325
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v4No1 / 328
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
710amnon high in feces compared to small intestine stomach in state of california swiss webster research facility united states of america mus musculus mouse 2028-05-20v4No1 / 329
111amnoncommon caecum, mongolian sheep, ovis aries, rectum, ileum, colon, china2017-04-09v4No1 / 330
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 341
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v4No1 / 343
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
792amnoncommon depth (soil) 20-60cm, nitraria tangutorum, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 352
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth (soil) 50cm jiulong river fujian province china )2017-11-23v4No1 / 356
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 360
916amnoncommon age 2 months, caecum, rabbit, oryctolagus cuniculus, research facility, kingdom of spain2022-07-04v4No1 / 361
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in urban slum infant stage dhaka bangladesh infant homo sapiens feces 2022-04-03v4No1 / 363
902amnon high in colitis colitis antibiotics induced colitis antibiotic compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 364
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 378
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
792amnon high in soil compared to haloxylon ammodendron nitraria tangutorum rhizosphere in depth (soil) 20-60cm sand ph 9 minqin county depth (soil) 50cm desert china 2021-06-07v4No1 / 432
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to under-1-year-old human stage infant in homo sapiens feces india 2018-05-24v4No1 / 457
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
80amnon high in tropical moist broadleaf forest biome compared to dry forest in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 465
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 470
738amnon high in age 30 days compared to age 1 week in caecum united kingdom chicken gallus gallus 2021-01-30v3No1 / 474
214amnon high in diet nih 31m chow mouse chow compared to high fat diet in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 495
927amnon high in punta licosa compared to licosa island in lizard podarcis siculus italy feces 2022-08-15v3No1 / 509
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 517
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
273amnon high in 1-year-old human stage age compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant finland )2017-11-12v4No1 / 567
160amnoncommon in wastewater treatment plant effluent in spring in china (common spring, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 573
399amnoncommon feces, united states of america, oryctolagus cuniculus, rabbit, research facility2018-11-16v4No1 / 577
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
536amnon high in terrestrial snake compared to aquatic snake in snake skin united states of america southern united states 2019-07-28v4No1 / 590
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in kingdom of spain water estuary estuary water bilbao 2019-03-20v4No1 / 592
792amnoncommon depth (soil) 20-60cm, sand, ph 9, minqin county, depth (soil) 50cm, soil, desert, china2021-06-07v4No1 / 595
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
443amnon high in free floating filtered 0.2um compared to particles filtered 2.7um in water river fresh water depth (water) 1m united states of america mississippi river 2019-01-07v4No1 / 755
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 780
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common paenibacillus polymyxa, paenibacillus, compost, compost biofilter, pig manure, bio-organic fertilizer, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 866
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 875
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, fusarium oxysporum f. sp. chrysanthemi, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 922
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common dazomet, soil fumigation, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county, bio-organic fertilizer, compost biofilter, paenibacillus polymyxa, paenibacillus, compost soil, pig manure, conventional tillage, deep plough)2021-04-18v4No1 / 1109
916amnon high in farm2 compared to farm1 in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 1191
649amnon high in colon compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 1261
863amnon high in yuzhong county xinglong mountain national nature reserve moschus chrysogaster alpine musk deer compared to moschus berezovskii qilian county forest musk deer in china deer captive farm feces 2022-01-28v4No1 / 1311
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
137amnoncommon gopherus polyphemus, gopher tortoise, feces, united states of america, state of florida2017-04-17v4No1 / 1622
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3936
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596

Problems / suggestions? Please email info AT dbbact DOT org