Search result for sequence:
TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATGTCGGGGCTCAACCCCGAAACTGCCTCTAATACTGTTGGACTAGAGAATAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
mus musculus0.546584
mouse0.525770
research facility0.329218
c57bl/60.251748
male0.250000
high fat diet0.217391
caecum0.203160
balb/c0.184615
feces0.154176
charles river laboratories0.145455
swiss webster0.140351
c57bl/6ncrl0.140351
united states of america0.132919
mouse chow0.128342
female0.123203
LOWER IN c57bl/60.109091
finland0.103896
sweden0.096000
c57bl/6j0.093750
diet0.082474
colon0.077419
low fat diet0.075472
nzb/w f10.075472
house mice0.075472
harlan sprague dawley0.075472
state of maryland0.075472
heavy metal0.075472
ketogenic diet0.072727
wistar rat0.072727
obesity0.072727
bolivia0.070175
new york city0.070175
rattus0.065574
LOWER IN mouse chow0.065574
control diet0.063492
czech republic0.063492
israel0.057971
japan0.056338
rat0.054795
wild0.054795
city0.048193
age 24 weeks0.039216
LOWER IN age 3 weeks0.039216
obese body mass index status0.039216
db/db mouse0.039216
il1-alpha knockout0.039216
LOWER IN a/j0.039216
manhatten region0.039216
LOWER IN queens region0.039216
polydextrose0.039216
high fat diet + polydextrose0.039216
LOWER IN high fat diet + polydextrose0.039216
LOWER IN polydextrose0.039216
a/j0.039216
LOWER IN ecuador0.039216
LOWER IN nih-31m chow0.039216
dexamethasone0.039216
state of iowa0.039216
cf-10.039216
LOWER IN esophagus0.039216
every other day fasting0.039216
sea urchin0.039216
artificial seawater0.039216
ph 7-90.039216
lean body mass0.038462
LOWER IN hymenolepis diminuta0.038462
western diet0.038462
LOWER IN systemic lupus erythematosus0.038462
lytechinus variegatus0.038462
LOWER IN tongue0.038462
switzerland0.037736
gastrointestinal system0.037736
fasting0.037736
LOWER IN jackson laboratories0.037736
LOWER IN stomach0.035714
LOWER IN mouth0.035714
LOWER IN duodenum0.035088
LOWER IN ileum0.035088
rectum0.034483
LOWER IN high fat diet0.033898
china0.032345
state of florida0.032258
LOWER IN winter0.031746
summer0.029851
age0.029412
soil0.026144
sea water0.025641
control0.022472
Fraction of dbbact annotations with this term covered by the query
TermScore
male1.000000
charles river laboratories0.666667
swiss webster0.500000
c57bl/6ncrl0.500000
age 24 weeks0.500000
LOWER IN age 3 weeks0.500000
low fat diet0.500000
obese body mass index status0.500000
db/db mouse0.500000
il1-alpha knockout0.500000
LOWER IN c57bl/60.500000
LOWER IN a/j0.500000
nzb/w f10.500000
house mice0.500000
manhatten region0.500000
LOWER IN queens region0.500000
polydextrose0.500000
high fat diet + polydextrose0.500000
harlan sprague dawley0.500000
LOWER IN high fat diet + polydextrose0.500000
LOWER IN polydextrose0.500000
a/j0.500000
LOWER IN ecuador0.500000
LOWER IN nih-31m chow0.500000
dexamethasone0.500000
state of iowa0.500000
cf-10.500000
LOWER IN esophagus0.500000
state of maryland0.500000
every other day fasting0.500000
sea urchin0.500000
artificial seawater0.500000
heavy metal0.500000
ph 7-90.500000
high fat diet0.454545
c57bl/60.400000
mus musculus0.392857
mouse0.387755
balb/c0.375000
ketogenic diet0.333333
lean body mass0.333333
wistar rat0.333333
LOWER IN hymenolepis diminuta0.333333
obesity0.333333
western diet0.333333
LOWER IN systemic lupus erythematosus0.333333
lytechinus variegatus0.333333
LOWER IN tongue0.333333
mouse chow0.300000
bolivia0.250000
new york city0.250000
switzerland0.250000
gastrointestinal system0.250000
fasting0.250000
LOWER IN jackson laboratories0.250000
caecum0.227273
sweden0.222222
research facility0.206186
c57bl/6j0.200000
rattus0.166667
LOWER IN mouse chow0.166667
control diet0.142857
finland0.142857
czech republic0.142857
LOWER IN stomach0.142857
LOWER IN mouth0.142857
LOWER IN duodenum0.125000
LOWER IN ileum0.125000
rectum0.111111
colon0.105263
LOWER IN high fat diet0.100000
israel0.100000
japan0.090909
female0.088235
feces0.086124
diet0.083333
rat0.083333
wild0.083333
state of florida0.076923
united states of america0.074866
LOWER IN winter0.071429
city0.058824
summer0.055556
age0.052632
sea water0.034483
china0.021978
soil0.019231
control0.015504
Fraction of annotations for the query sequences containing the term
TermScore
mus musculus0.897959
mouse0.816327
research facility0.816327
feces0.734694
united states of america0.591837
female0.204082
caecum0.183673
c57bl/60.183673
male0.142857
high fat diet0.142857
balb/c0.122449
swiss webster0.081633
c57bl/6ncrl0.081633
finland0.081633
diet0.081633
mouse chow0.081633
charles river laboratories0.081633
c57bl/6j0.061224
LOWER IN c57bl/60.061224
sweden0.061224
colon0.061224
china0.061224
ketogenic diet0.040816
control diet0.040816
low fat diet0.040816
control0.040816
rattus0.040816
rat0.040816
wistar rat0.040816
czech republic0.040816
wild0.040816
bolivia0.040816
obesity0.040816
israel0.040816
nzb/w f10.040816
house mice0.040816
new york city0.040816
city0.040816
harlan sprague dawley0.040816
LOWER IN mouse chow0.040816
japan0.040816
state of maryland0.040816
soil0.040816
heavy metal0.040816
age 24 weeks0.020408
age0.020408
LOWER IN age 3 weeks0.020408
LOWER IN high fat diet0.020408
lean body mass0.020408
LOWER IN hymenolepis diminuta0.020408
obese body mass index status0.020408
db/db mouse0.020408
il1-alpha knockout0.020408
LOWER IN a/j0.020408
western diet0.020408
manhatten region0.020408
LOWER IN queens region0.020408
polydextrose0.020408
high fat diet + polydextrose0.020408
LOWER IN high fat diet + polydextrose0.020408
LOWER IN polydextrose0.020408
switzerland0.020408
a/j0.020408
LOWER IN ecuador0.020408
LOWER IN nih-31m chow0.020408
dexamethasone0.020408
LOWER IN systemic lupus erythematosus0.020408
state of iowa0.020408
cf-10.020408
gastrointestinal system0.020408
rectum0.020408
LOWER IN esophagus0.020408
LOWER IN stomach0.020408
LOWER IN duodenum0.020408
LOWER IN ileum0.020408
LOWER IN mouth0.020408
fasting0.020408
every other day fasting0.020408
sea urchin0.020408
lytechinus variegatus0.020408
state of florida0.020408
artificial seawater0.020408
sea water0.020408
LOWER IN tongue0.020408
LOWER IN jackson laboratories0.020408
summer0.020408
LOWER IN winter0.020408
ph 7-90.020408
Exp. ID User ID Description Date Region Flag Sequences
405amnonhighfreq mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
405amnonhighfreq mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
457amnonhighfreq mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 20
124amnonhighfreq mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 21
458amnonpositively correlated with age ( high in age 24 weeks age compared to age 3 weeks in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 99
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 120
386amnoncommon mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 129
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il1-alpha knockout compared to c57bl/6 in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 145
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 147
368amnoncommon feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 161
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 161
337amnonhigher in manhattan compared to queens in feces of house mice from new york city ( high in manhatten region compared to queens region in mus musculus house mice mouse new york city united states of america city )2018-05-18v4No1 / 162
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 167
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 184
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 186
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 224
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
386amnon high in bolivia compared to ecuador in mouse mus musculus caecum wild 2018-10-28v4No1 / 246
214amnon high in diet high fat diet compared to nih-31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
368amnonhigher in sle model mice treated with dexamethasone (reduced symptoms) ( high in dexamethasone compared to systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-04v4No1 / 257
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 297
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
13amnon high in caecum colon rectum feces compared to esophagus stomach duodenum ileum mouth in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 316
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v4No1 / 343
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133

Problems / suggestions? Please email info AT dbbact DOT org