Search result for sequence:
TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATGTCGGGGCTCAACCCCGAAACTGCCTCTAATACTGTTGGACTAGAGAATAGTTGCGGTAGGCGGAATGTATGG
common ontology terms
term enrichment score
TermScore
mus musculus0.538481
mouse0.518697
caecum0.387097
research facility0.327381
male0.242424
c57bl/60.230769
high fat diet0.197740
balb/c0.171429
feces0.149020
charles river laboratories0.133333
swiss webster0.129032
c57bl/6ncrl0.129032
united states of america0.123856
mouse chow0.116505
female0.108696
israel0.100000
age 9 months0.100000
LOWER IN c57bl/60.100000
finland0.097561
rat0.097561
canada0.095238
cecal content0.086957
c57bl/6j0.086957
sweden0.086957
diet0.078431
colon0.072727
nzb/w f10.068966
house mice0.068966
harlan sprague dawley0.068966
state of maryland0.068966
heavy metal0.068966
ketogenic diet0.066667
low fat diet0.066667
wistar rat0.066667
obesity0.066667
bolivia0.064516
fructose diet0.064516
fructose0.064516
new york city0.064516
rattus0.060606
LOWER IN mouse chow0.059701
czech republic0.058824
control diet0.057143
rattus norvegicus0.055556
sprague dawley0.055556
japan0.052632
wild0.045455
city0.044444
LOWER IN nicotine dependence0.035714
age 24 weeks0.035714
LOWER IN age 3 weeks0.035714
obese body mass index status0.035714
db/db mouse0.035714
il1-alpha knockout0.035714
LOWER IN a/j0.035714
manhatten region0.035714
LOWER IN queens region0.035714
polydextrose0.035714
high fat diet + polydextrose0.035714
LOWER IN high fat diet + polydextrose0.035714
LOWER IN polydextrose0.035714
a/j0.035714
LOWER IN ecuador0.035714
LOWER IN nih-31m chow0.035714
dexamethasone0.035714
state of iowa0.035714
cf-10.035714
LOWER IN esophagus0.035714
every other day fasting0.035714
sea urchin0.035714
artificial seawater0.035714
ph 7-90.035714
lean body mass0.035088
LOWER IN hymenolepis diminuta0.035088
western diet0.035088
LOWER IN systemic lupus erythematosus0.035088
lytechinus variegatus0.035088
LOWER IN tongue0.035088
fasting0.034483
LOWER IN jackson laboratories0.034483
gastrointestinal system0.033898
switzerland0.033333
LOWER IN mouth0.032787
LOWER IN control diet0.032258
LOWER IN stomach0.032258
LOWER IN duodenum0.032258
LOWER IN ileum0.031746
rectum0.031250
control0.030769
LOWER IN high fat diet0.030769
LOWER IN winter0.029412
state of florida0.028986
china0.028169
summer0.027778
age0.027397
sea water0.024096
soil0.022222
Fraction of dbbact annotations with this term covered by the query
TermScore
caecum1.500000
charles river laboratories0.666667
swiss webster0.500000
age 9 months0.500000
c57bl/6ncrl0.500000
LOWER IN nicotine dependence0.500000
age 24 weeks0.500000
LOWER IN age 3 weeks0.500000
obese body mass index status0.500000
db/db mouse0.500000
il1-alpha knockout0.500000
LOWER IN c57bl/60.500000
LOWER IN a/j0.500000
nzb/w f10.500000
house mice0.500000
manhatten region0.500000
LOWER IN queens region0.500000
polydextrose0.500000
high fat diet + polydextrose0.500000
harlan sprague dawley0.500000
LOWER IN high fat diet + polydextrose0.500000
LOWER IN polydextrose0.500000
a/j0.500000
LOWER IN ecuador0.500000
LOWER IN nih-31m chow0.500000
dexamethasone0.500000
state of iowa0.500000
cf-10.500000
LOWER IN esophagus0.500000
state of maryland0.500000
every other day fasting0.500000
sea urchin0.500000
artificial seawater0.500000
heavy metal0.500000
ph 7-90.500000
male0.444444
high fat diet0.416667
mus musculus0.389831
mouse0.384615
balb/c0.375000
c57bl/60.375000
ketogenic diet0.333333
canada0.333333
low fat diet0.333333
lean body mass0.333333
wistar rat0.333333
LOWER IN hymenolepis diminuta0.333333
obesity0.333333
western diet0.333333
LOWER IN systemic lupus erythematosus0.333333
lytechinus variegatus0.333333
LOWER IN tongue0.333333
mouse chow0.272727
bolivia0.250000
fructose diet0.250000
fructose0.250000
new york city0.250000
fasting0.250000
LOWER IN jackson laboratories0.250000
research facility0.203704
cecal content0.200000
c57bl/6j0.200000
sweden0.200000
gastrointestinal system0.200000
rattus0.166667
switzerland0.166667
israel0.153846
LOWER IN mouse chow0.153846
finland0.142857
rat0.142857
czech republic0.142857
LOWER IN mouth0.142857
control diet0.125000
LOWER IN control diet0.125000
LOWER IN stomach0.125000
LOWER IN duodenum0.125000
rattus norvegicus0.111111
sprague dawley0.111111
LOWER IN ileum0.111111
colon0.105263
rectum0.100000
LOWER IN high fat diet0.090909
japan0.090909
feces0.083333
diet0.083333
female0.076923
LOWER IN winter0.071429
united states of america0.070000
state of florida0.066667
wild0.058824
city0.055556
summer0.055556
age0.052632
sea water0.034483
control0.021277
china0.018868
soil0.015873
Fraction of annotations for the query sequences containing the term
TermScore
mus musculus0.870370
research facility0.833333
mouse0.796296
feces0.703704
united states of america0.537037
caecum0.222222
female0.185185
male0.166667
c57bl/60.166667
high fat diet0.129630
balb/c0.111111
swiss webster0.074074
c57bl/6ncrl0.074074
finland0.074074
diet0.074074
mouse chow0.074074
rat0.074074
israel0.074074
charles river laboratories0.074074
canada0.055556
age 9 months0.055556
cecal content0.055556
c57bl/6j0.055556
control0.055556
LOWER IN c57bl/60.055556
sweden0.055556
colon0.055556
china0.055556
ketogenic diet0.037037
control diet0.037037
low fat diet0.037037
rattus0.037037
wistar rat0.037037
czech republic0.037037
wild0.037037
bolivia0.037037
rattus norvegicus0.037037
sprague dawley0.037037
fructose diet0.037037
fructose0.037037
obesity0.037037
nzb/w f10.037037
house mice0.037037
new york city0.037037
city0.037037
harlan sprague dawley0.037037
LOWER IN mouse chow0.037037
japan0.037037
state of maryland0.037037
soil0.037037
heavy metal0.037037
LOWER IN nicotine dependence0.018519
age 24 weeks0.018519
age0.018519
LOWER IN age 3 weeks0.018519
LOWER IN high fat diet0.018519
lean body mass0.018519
LOWER IN hymenolepis diminuta0.018519
LOWER IN control diet0.018519
obese body mass index status0.018519
db/db mouse0.018519
il1-alpha knockout0.018519
LOWER IN a/j0.018519
western diet0.018519
manhatten region0.018519
LOWER IN queens region0.018519
polydextrose0.018519
high fat diet + polydextrose0.018519
LOWER IN high fat diet + polydextrose0.018519
LOWER IN polydextrose0.018519
switzerland0.018519
a/j0.018519
LOWER IN ecuador0.018519
LOWER IN nih-31m chow0.018519
dexamethasone0.018519
LOWER IN systemic lupus erythematosus0.018519
state of iowa0.018519
cf-10.018519
gastrointestinal system0.018519
rectum0.018519
LOWER IN esophagus0.018519
LOWER IN stomach0.018519
LOWER IN duodenum0.018519
LOWER IN ileum0.018519
LOWER IN mouth0.018519
fasting0.018519
every other day fasting0.018519
sea urchin0.018519
lytechinus variegatus0.018519
state of florida0.018519
artificial seawater0.018519
sea water0.018519
LOWER IN tongue0.018519
LOWER IN jackson laboratories0.018519
summer0.018519
LOWER IN winter0.018519
ph 7-90.018519
Exp. ID User ID Description Date Region Flag Sequences
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
611amnondominant mouse, mus musculus, canada, research facility, age 9 months, cecal content, caecum2020-04-21v4No1 / 17
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 20
124amnondominant mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 21
611amnonlower in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in control compared to nicotine dependence in mouse mus musculus canada research facility age 9 months cecal content caecum )2020-04-21v4No1 / 66
458amnonpositively correlated with age ( high in age 24 weeks age compared to age 3 weeks in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 99
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 120
386amnoncommon mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 129
586amnon high in fructose diet fructose compared to control diet in rattus norvegicus rat sprague dawley research facility male israel feces 2020-02-09v4No1 / 130
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il1-alpha knockout compared to c57bl/6 in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 145
611amnoncommon mouse, mus musculus, canada, research facility, age 9 months, cecal content, caecum2020-04-21v4No1 / 145
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 147
368amnoncommon feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 161
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 161
337amnonhigher in manhattan compared to queens in feces of house mice from new york city ( high in manhatten region compared to queens region in mus musculus house mice mouse new york city united states of america city )2018-05-18v4No1 / 162
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 167
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 184
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 186
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 224
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
386amnon high in bolivia compared to ecuador in mouse mus musculus caecum wild 2018-10-28v4No1 / 246
214amnon high in diet high fat diet compared to nih-31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
368amnonhigher in sle model mice treated with dexamethasone (reduced symptoms) ( high in dexamethasone compared to systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-04v4No1 / 257
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v4No1 / 287
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 297
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
13amnon high in caecum colon rectum feces compared to esophagus stomach duodenum ileum mouth in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 316
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v4No1 / 343
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133

Problems / suggestions? Please email info AT dbbact DOT org