Search result for sequence:
TACGGAGGATGCAAGCGTTATCCGGATTCATTGGGTTTAAAGGGTACGTAGGTGGCCTGATAAGTCAGTGGTGAAAGTTTGCCGCTTAACGGTAAAATTGCCATTGATACTGTCGGGCTTGAGTGCAGCTGAGGTAGGCGGAATGTGTAG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
mangrove swamp0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
kandelia candel0.500000
hainan autonomous prefecture0.333333
mangrove0.333333
zhejiang province0.166667
depth 0-20cm0.142857
marine sediment0.071429
rhizosphere0.030303
china0.018868
soil0.015873
Fraction of annotations for the query sequences containing the term
TermScore
china1.000000
mangrove swamp1.000000
soil0.750000
marine sediment0.750000
depth 0-20cm0.750000
hainan autonomous prefecture0.500000
mangrove0.500000
danzhou xinyinggang nature reserve0.250000
rhizophora stylosa0.250000
dongzhaigang national nature reserve0.250000
mudflat0.250000
zhejiang province0.250000
futian national nature reserve0.250000
kandelia candel0.250000
rhizosphere0.250000

Problems / suggestions? Please email info AT dbbact DOT org