Search result for sequence:
TACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTACGTAGGCGGAAGATTAAGTCAGTGGTGAAATCCTGCAGCTTAACTGTAGAACTGTCATTGATACTGGTTTTCTTGAATGCAGTTGAGGTAGGCGGAATATGTAA
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
spartina alterniflora0.666667
saline marsh0.500000
mangrove swamp0.500000
kandelia candel0.500000
dongzhaigang national nature reserve0.500000
mudflat0.500000
futian national nature reserve0.500000
shenzhen futian national nature reserve0.500000
low salinity0.333333
LOWER IN high salinity0.333333
mangrove0.333333
hainan autonomous prefecture0.333333
guangdong province0.333333
zhejiang province0.166667
depth 0-20cm0.142857
atlantic ocean0.125000
marine sediment0.071429
rhizosphere0.060606
sediment0.043478
china0.018868
soil0.015873
united states of america0.005000
Fraction of annotations for the query sequences containing the term
TermScore
china0.888889
mangrove swamp0.888889
soil0.777778
marine sediment0.777778
depth 0-20cm0.777778
mangrove0.333333
kandelia candel0.333333
mudflat0.333333
zhejiang province0.333333
futian national nature reserve0.333333
rhizosphere0.222222
spartina alterniflora0.222222
hainan autonomous prefecture0.222222
dongzhaigang national nature reserve0.222222
guangdong province0.222222
shenzhen futian national nature reserve0.222222
saline marsh0.111111
united states of america0.111111
atlantic ocean0.111111
sediment0.111111
low salinity0.111111
LOWER IN high salinity0.111111
Exp. ID User ID Description Date Region Flag Sequences
376amnonhigher in salt marsh with low salinity (11) compared to higher salinity (25-30) ( high in low salinity compared to high salinity in rhizosphere saline marsh united states of america atlantic ocean sediment spartina alterniflora )2018-09-11v4No1 / 1038
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
571amnoncommon china, soil, mangrove swamp, marine sediment, depth 0-20cm, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747

Problems / suggestions? Please email info AT dbbact DOT org