Search result for sequence:
TACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGATAGTTAAGTCAGCGGTGAAATCTCACGGCTCAACCGTGGAACTGCCGTTGATACTGGCTGTCTGGAGTACGGACGGCGCCGGCGGAATGTGTCA
common ontology terms
term enrichment score
TermScore
rumen0.615385
mongolian sheep0.375000
holstein-friesian bull0.375000
ovis aries0.363636
cecum0.285714
ireland0.272727
bos taurus0.250000
660 days0.166667
LOWER IN 605 days0.166667
camel0.166667
camelus dromedarius0.166667
LOWER IN fresh clover diet0.166667
clover hay diet0.166667
ruminal fluid0.166667
alpine meadow0.166667
LOWER IN restricted diet0.166667
ileum0.153846
ruminant reticulum0.153846
omasum0.153846
yak0.153846
sheep0.142857
bos grunniens0.142857
rectum0.142857
egypt0.133333
normal diet0.133333
tibetan plateau0.125000
diet0.117647
kingdom of norway0.111111
sweden0.105263
colon0.083333
age0.068966
china0.041667
adult0.021277
control0.014388
Fraction of dbbact annotations with this term covered by the query
TermScore
mongolian sheep0.500000
cecum0.500000
rumen0.500000
holstein-friesian bull0.500000
660 days0.500000
LOWER IN 605 days0.500000
camel0.500000
camelus dromedarius0.500000
LOWER IN fresh clover diet0.500000
clover hay diet0.500000
ruminal fluid0.500000
alpine meadow0.500000
LOWER IN restricted diet0.500000
ovis aries0.333333
ruminant reticulum0.333333
omasum0.333333
yak0.333333
ireland0.250000
sheep0.250000
bos grunniens0.250000
egypt0.200000
normal diet0.200000
bos taurus0.181818
tibetan plateau0.166667
ileum0.125000
kingdom of norway0.125000
rectum0.111111
sweden0.111111
diet0.083333
colon0.052632
age0.052632
china0.021978
adult0.011905
control0.007752
Fraction of annotations for the query sequences containing the term
TermScore
rumen0.800000
ovis aries0.400000
china0.400000
bos taurus0.400000
mongolian sheep0.300000
holstein-friesian bull0.300000
ireland0.300000
rectum0.200000
ileum0.200000
cecum0.200000
colon0.200000
diet0.200000
age0.100000
660 days0.100000
LOWER IN 605 days0.100000
ruminant reticulum0.100000
omasum0.100000
egypt0.100000
camel0.100000
camelus dromedarius0.100000
adult0.100000
LOWER IN fresh clover diet0.100000
clover hay diet0.100000
sheep0.100000
kingdom of norway0.100000
ruminal fluid0.100000
alpine meadow0.100000
tibetan plateau0.100000
yak0.100000
bos grunniens0.100000
control0.100000
LOWER IN restricted diet0.100000
normal diet0.100000
sweden0.100000

Problems / suggestions? Please email info AT dbbact DOT org