Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGAATTATTGGGTTTAAAGGGTGCGTAGGCTGTTTGTTAAGTCAGGGGTGAAATACCGCAGCTCAACTGTGGAATTGCCTTTGATACTAGCAGGCTTGAATACTGTTGCCGTGGGAGGAATGAGTAG
common ontology terms
term enrichment score
TermScore
zoological garden0.473684
sus scrofa0.250000
pig0.250000
rural community0.208955
gorilla gorilla0.191388
hunter gatherer0.155844
mongolian sheep0.148148
caecum0.148148
chuquisaca department0.148148
pan troglodytes0.148148
chimpanzee0.148148
united kingdom0.145985
age 5-13 years0.137931
bolivia0.129032
ileum0.125000
state of tennessee0.121212
feces0.120210
amerindian0.118812
venezuela0.118812
papio anubis0.118812
como zoo0.115385
LOWER IN united states of america0.109091
ovis aries0.108108
child0.104348
monkey0.103448
LOWER IN wild0.098361
state of minnesota0.093750
homo sapiens0.086290
olive baboon0.081633
cecum0.080000
tunapuco0.080000
weaned0.080000
age 4-7 weeks0.080000
corn and soybean diet0.080000
lincoln park zoo0.080000
saint louis zoo0.080000
saint louis0.080000
LOWER IN nouabale-ndoki national park0.080000
LOWER IN republic of congo0.080000
rectum0.078947
peru0.076923
jiangxi province0.076923
chicago0.076923
canada0.076923
LOWER IN mouth mucosa0.076923
LOWER IN city0.075472
small village0.074074
left colon0.074074
egypt0.071429
right colon0.071429
skin0.069364
rumen0.068966
farm0.068182
LOWER IN mouth0.066667
captive0.064516
obsolete_juvenile stage0.060606
colon0.058252
united states of america0.055236
china0.047727
adult0.045283
himalayas0.041667
chepang0.041667
LOWER IN tharu0.041667
LOWER IN agrarian0.041667
intestinal contents0.041667
white-faced saki0.041667
pithecia pithecia0.041667
age 12-19 weeks0.041667
LOWER IN age 6-10 weeks0.041667
gorilla0.041667
black-handed spider monkey0.041667
ateles geoffroyi0.041667
hadza0.041667
heavy metal0.041667
macropus rufus0.041667
red kangaroo0.041667
african lion safari0.041667
zambia0.041667
baboon0.041667
papio0.041667
LOWER IN papio kindae0.041667
LOWER IN papio ursinus0.041667
toronto zoo0.041667
LOWER IN state of oklahoma0.041667
LOWER IN arm0.041667
LOWER IN forearm0.041667
LOWER IN preweaned0.041667
LOWER IN suckling0.041667
LOWER IN age 2-4 weeks0.041667
LOWER IN pan troglodytes troglodytes0.041667
forearm0.041667
gorilla gorilla gorilla0.041667
nepal0.040816
forager0.040816
LOWER IN mucosa0.040816
tonsil0.040816
ruminant reticulum0.040816
omasum0.040816
state of nebraska0.040816
tanzania0.040816
Fraction of dbbact annotations with this term covered by the query
TermScore
gorilla gorilla0.800000
hunter gatherer0.750000
amerindian0.666667
venezuela0.666667
papio anubis0.666667
olive baboon0.666667
zoological garden0.600000
mongolian sheep0.500000
cecum0.500000
himalayas0.500000
chepang0.500000
LOWER IN tharu0.500000
LOWER IN agrarian0.500000
caecum0.500000
intestinal contents0.500000
chuquisaca department0.500000
como zoo0.500000
white-faced saki0.500000
pithecia pithecia0.500000
age 12-19 weeks0.500000
LOWER IN age 6-10 weeks0.500000
gorilla0.500000
black-handed spider monkey0.500000
ateles geoffroyi0.500000
tunapuco0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
hadza0.500000
heavy metal0.500000
lincoln park zoo0.500000
pan troglodytes0.500000
chimpanzee0.500000
macropus rufus0.500000
red kangaroo0.500000
african lion safari0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
toronto zoo0.500000
saint louis zoo0.500000
saint louis0.500000
LOWER IN state of oklahoma0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
LOWER IN pan troglodytes troglodytes0.500000
forearm0.500000
gorilla gorilla gorilla0.500000
sus scrofa0.444444
pig0.444444
nepal0.333333
rural community0.333333
forager0.333333
LOWER IN mucosa0.333333
age 5-13 years0.333333
LOWER IN united states of america0.333333
tonsil0.333333
ruminant reticulum0.333333
omasum0.333333
peru0.333333
state of nebraska0.333333
jiangxi province0.333333
tanzania0.333333
chicago0.333333
canada0.333333
jejunum0.333333
macaque0.333333
LOWER IN rumen0.333333
LOWER IN jejunum0.333333
LOWER IN mouth mucosa0.333333
arm0.333333
LOWER IN city0.285714
bolivia0.250000
monkey0.250000
small village0.250000
macaca mulatta0.250000
LOWER IN ruminant reticulum0.250000
LOWER IN omasum0.250000
left colon0.250000
gay0.250000
ileum0.222222
united kingdom0.222222
egypt0.200000
state of tennessee0.200000
body mass index0.200000
LOWER IN wild0.200000
right colon0.200000
LOWER IN msw0.200000
LOWER IN heterosexual0.200000
state of minnesota0.166667
rumen0.166667
dry season0.166667
LOWER IN wet season0.166667
Fraction of annotations for the query sequences containing the term
TermScore
feces0.695652
zoological garden0.391304
united states of america0.347826
homo sapiens0.326087
sus scrofa0.173913
pig0.173913
china0.152174
rural community0.152174
child0.130435
united kingdom0.108696
gorilla gorilla0.108696
mongolian sheep0.086957
ovis aries0.086957
ileum0.086957
adult0.086957
caecum0.086957
age 5-13 years0.086957
bolivia0.086957
chuquisaca department0.086957
hunter gatherer0.086957
state of tennessee0.086957
pan troglodytes0.086957
chimpanzee0.086957
rectum0.065217
colon0.065217
amerindian0.065217
venezuela0.065217
LOWER IN united states of america0.065217
state of minnesota0.065217
como zoo0.065217
farm0.065217
monkey0.065217
papio anubis0.065217
skin0.065217
LOWER IN wild0.065217
cecum0.043478
egypt0.043478
obsolete_juvenile stage0.043478
rumen0.043478
peru0.043478
small village0.043478
tunapuco0.043478
jiangxi province0.043478
weaned0.043478
age 4-7 weeks0.043478
corn and soybean diet0.043478
olive baboon0.043478
lincoln park zoo0.043478
chicago0.043478
canada0.043478
captive0.043478
saint louis zoo0.043478
saint louis0.043478
LOWER IN city0.043478
right colon0.043478
left colon0.043478
LOWER IN mouth mucosa0.043478
LOWER IN mouth0.043478
LOWER IN nouabale-ndoki national park0.043478
LOWER IN republic of congo0.043478
himalayas0.021739
nepal0.021739
chepang0.021739
forager0.021739
LOWER IN tharu0.021739
LOWER IN agrarian0.021739
LOWER IN mucosa0.021739
intestinal contents0.021739
white-faced saki0.021739
pithecia pithecia0.021739
tonsil0.021739
state of michigan0.021739
age 12-19 weeks0.021739
LOWER IN age 6-10 weeks0.021739
french republic0.021739
gorilla0.021739
ruminant reticulum0.021739
omasum0.021739
black-handed spider monkey0.021739
ateles geoffroyi0.021739
bos taurus0.021739
cow0.021739
state of nebraska0.021739
tanzania0.021739
hadza0.021739
dry season0.021739
LOWER IN wet season0.021739
winter0.021739
LOWER IN summer0.021739
soil0.021739
heavy metal0.021739
body mass index0.021739
low bmi0.021739
LOWER IN high bmi0.021739
macropus rufus0.021739
red kangaroo0.021739
african lion safari0.021739
zambia0.021739
baboon0.021739
papio0.021739
Exp. ID User ID Description Date Region Flag Sequences
111amnondominant mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 13
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in chepang forager compared to tharu agrarian in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 73
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
625amnoncommon state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 179
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 253
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 256
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
261amnoncommon bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 266
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
625amnoncommon gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 293
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
565amnoncommon skin, canada, macropus rufus, red kangaroo, zoological garden, captive, african lion safari2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
565amnoncommon skin, canada, papio anubis, olive baboon, zoological garden, captive, toronto zoo2019-11-21v3No1 / 368
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
620amnoncommon saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 433
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 530
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org