Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGAATTATTGGGTTTAAAGGGTGCGTAGGCTGTTTGTTAAGTCAGGGGTGAAATACCGCAGCTCAACTGTGGAATTGCCTTTGATACTAGCAGGCTTGAATACTGTTGCCGTGGGAGGAATGAGTAG
common ontology terms
term enrichment score
TermScore
zoological garden0.327273
sus scrofa0.290909
pig0.290909
rural community0.262500
hunter gatherer0.188976
mongolian sheep0.177778
chuquisaca department0.177778
united kingdom0.168067
age 5-13 years0.163265
ileum0.150943
bolivia0.150943
amerindian0.144578
venezuela0.144578
papio anubis0.144578
state of tennessee0.140351
LOWER IN united states of america0.133333
ovis aries0.131148
child0.123711
monkey0.122449
feces0.113086
gorilla gorilla0.100000
olive baboon0.100000
caecum0.098765
cecum0.097561
tunapuco0.097561
weaned0.097561
age 4-7 weeks0.097561
corn and soybean diet0.097561
canada0.097561
homo sapiens0.095137
rectum0.093750
peru0.093023
jiangxi province0.093023
LOWER IN city0.093023
LOWER IN mouth mucosa0.093023
small village0.088889
left colon0.088889
egypt0.085106
right colon0.085106
farm0.083916
rumen0.081633
captive0.081633
skin0.080537
LOWER IN mouth0.078431
obsolete_juvenile stage0.070175
colon0.063830
china0.056150
adult0.053691
himalayas0.051282
chepang0.051282
LOWER IN tharu0.051282
LOWER IN agrarian0.051282
intestinal contents0.051282
age 12-19 weeks0.051282
LOWER IN age 6-10 weeks0.051282
gorilla0.051282
hadza0.051282
heavy metal0.051282
african lion safari0.051282
red kangaroo0.051282
macropus rufus0.051282
zambia0.051282
baboon0.051282
papio0.051282
LOWER IN papio kindae0.051282
LOWER IN papio ursinus0.051282
toronto zoo0.051282
macaque0.051282
pan troglodytes0.051282
chimpanzee0.051282
LOWER IN state of oklahoma0.051282
LOWER IN arm0.051282
LOWER IN forearm0.051282
LOWER IN preweaned0.051282
LOWER IN suckling0.051282
LOWER IN age 2-4 weeks0.051282
forearm0.051282
nepal0.050000
forager0.050000
LOWER IN mucosa0.050000
tonsil0.050000
ruminant reticulum0.050000
omasum0.050000
state of nebraska0.050000
tanzania0.050000
jejunum0.050000
macaca mulatta0.050000
LOWER IN rumen0.050000
male0.050000
LOWER IN jejunum0.050000
arm0.050000
LOWER IN ruminant reticulum0.048780
LOWER IN omasum0.048780
LOWER IN heterosexual0.048780
LOWER IN msw0.048780
gay0.048780
body mass index0.047619
msm0.047619
homosexual0.047619
dry season0.046512
Fraction of dbbact annotations with this term covered by the query
TermScore
hunter gatherer0.750000
amerindian0.666667
venezuela0.666667
gorilla gorilla0.666667
papio anubis0.666667
olive baboon0.666667
mongolian sheep0.500000
cecum0.500000
himalayas0.500000
chepang0.500000
LOWER IN tharu0.500000
LOWER IN agrarian0.500000
intestinal contents0.500000
chuquisaca department0.500000
age 12-19 weeks0.500000
LOWER IN age 6-10 weeks0.500000
zoological garden0.500000
gorilla0.500000
tunapuco0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
hadza0.500000
heavy metal0.500000
african lion safari0.500000
red kangaroo0.500000
macropus rufus0.500000
canada0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
toronto zoo0.500000
macaque0.500000
pan troglodytes0.500000
chimpanzee0.500000
LOWER IN state of oklahoma0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
forearm0.500000
sus scrofa0.444444
pig0.444444
rural community0.428571
LOWER IN united states of america0.375000
nepal0.333333
forager0.333333
LOWER IN mucosa0.333333
age 5-13 years0.333333
tonsil0.333333
ruminant reticulum0.333333
omasum0.333333
peru0.333333
state of nebraska0.333333
jiangxi province0.333333
tanzania0.333333
jejunum0.333333
macaca mulatta0.333333
LOWER IN city0.333333
LOWER IN rumen0.333333
male0.333333
LOWER IN jejunum0.333333
LOWER IN mouth mucosa0.333333
arm0.333333
ileum0.250000
bolivia0.250000
monkey0.250000
small village0.250000
LOWER IN ruminant reticulum0.250000
LOWER IN omasum0.250000
left colon0.250000
LOWER IN heterosexual0.250000
LOWER IN msw0.250000
gay0.250000
united kingdom0.222222
egypt0.200000
state of tennessee0.200000
body mass index0.200000
right colon0.200000
msm0.200000
homosexual0.200000
ovis aries0.166667
rumen0.166667
dry season0.166667
LOWER IN wet season0.166667
low bmi0.166667
captive0.166667
LOWER IN skin0.166667
state of michigan0.142857
french republic0.142857
cow0.142857
LOWER IN high bmi0.142857
LOWER IN mouth0.142857
LOWER IN wild0.125000
hiv infection0.125000
LOWER IN duodenum0.125000
LOWER IN ileum0.125000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.621622
homo sapiens0.405405
zoological garden0.243243
sus scrofa0.216216
pig0.216216
china0.189189
rural community0.189189
united states of america0.189189
child0.162162
united kingdom0.135135
mongolian sheep0.108108
ovis aries0.108108
ileum0.108108
adult0.108108
caecum0.108108
age 5-13 years0.108108
bolivia0.108108
chuquisaca department0.108108
hunter gatherer0.108108
state of tennessee0.108108
rectum0.081081
colon0.081081
amerindian0.081081
venezuela0.081081
LOWER IN united states of america0.081081
farm0.081081
monkey0.081081
papio anubis0.081081
skin0.081081
cecum0.054054
egypt0.054054
obsolete_juvenile stage0.054054
gorilla gorilla0.054054
rumen0.054054
peru0.054054
small village0.054054
tunapuco0.054054
jiangxi province0.054054
weaned0.054054
age 4-7 weeks0.054054
corn and soybean diet0.054054
olive baboon0.054054
captive0.054054
canada0.054054
LOWER IN city0.054054
right colon0.054054
left colon0.054054
LOWER IN mouth mucosa0.054054
LOWER IN mouth0.054054
himalayas0.027027
nepal0.027027
chepang0.027027
forager0.027027
LOWER IN tharu0.027027
LOWER IN agrarian0.027027
LOWER IN mucosa0.027027
intestinal contents0.027027
tonsil0.027027
state of michigan0.027027
age 12-19 weeks0.027027
LOWER IN age 6-10 weeks0.027027
french republic0.027027
gorilla0.027027
ruminant reticulum0.027027
omasum0.027027
bos taurus0.027027
cow0.027027
state of nebraska0.027027
tanzania0.027027
hadza0.027027
dry season0.027027
LOWER IN wet season0.027027
winter0.027027
LOWER IN summer0.027027
soil0.027027
heavy metal0.027027
body mass index0.027027
low bmi0.027027
LOWER IN high bmi0.027027
african lion safari0.027027
red kangaroo0.027027
macropus rufus0.027027
zambia0.027027
baboon0.027027
papio0.027027
LOWER IN wild0.027027
LOWER IN papio kindae0.027027
LOWER IN papio ursinus0.027027
toronto zoo0.027027
duodenum0.027027
jejunum0.027027
macaca mulatta0.027027
macaque0.027027
pan troglodytes0.027027
chimpanzee0.027027
LOWER IN rumen0.027027
LOWER IN ruminant reticulum0.027027
LOWER IN omasum0.027027
LOWER IN state of oklahoma0.027027
LOWER IN heterosexual0.027027
Exp. ID User ID Description Date Region Flag Sequences
111amnonhighfreq mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 13
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in chepang forager compared to tharu agrarian in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 73
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 253
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
261amnoncommon bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 266
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
111amnoncommon mongolian sheep, ovis aries, rectum, ileum, cecum, colon, china2017-04-09v4No1 / 330
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
565amnoncommon african lion safari, captive, zoological garden, red kangaroo, macropus rufus, canada, skin2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
565amnoncommon toronto zoo, captive, zoological garden, olive baboon, papio anubis, canada, skin2019-11-21v3No1 / 368
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 407
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay msm homosexual compared to heterosexual msw in male adult sweden kingdom of spain hiv infection feces homo sapiens )2020-01-14v3No1 / 519
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org