Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGGGATTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGTTCCCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
age < 3 years0.307692
china0.222222
swan goose0.222222
poland0.200000
anser cygnoides0.200000
LOWER IN estonia0.200000
LOWER IN mongolia0.166667
LOWER IN 1-month-old human stage0.153846
russia0.148148
LOWER IN finland0.142857
belgium0.133333
kingdom of denmark0.133333
infant0.130435
LOWER IN switzerland0.125000
rectum0.111111
crohn's disease0.105263
bird0.100000
1-year-old human stage0.090909
winter0.083333
age0.071429
LOWER IN summer0.066667
feces0.037500
homo sapiens0.036123
female0.028571
adult0.022222
LOWER IN control0.010417
Fraction of dbbact annotations with this term covered by the query
TermScore
china0.500000
swan goose0.500000
anser cygnoides0.333333
LOWER IN estonia0.333333
age < 3 years0.333333
LOWER IN mongolia0.200000
LOWER IN 1-month-old human stage0.166667
poland0.153846
LOWER IN finland0.142857
belgium0.125000
kingdom of denmark0.125000
LOWER IN switzerland0.111111
russia0.100000
rectum0.090909
crohn's disease0.083333
bird0.076923
infant0.076923
1-year-old human stage0.066667
winter0.058824
age0.047619
LOWER IN summer0.043478
feces0.019108
homo sapiens0.018450
female0.015873
adult0.011561
LOWER IN control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.857143
infant0.428571
poland0.285714
adult0.285714
russia0.285714
age < 3 years0.285714
crohn's disease0.142857
LOWER IN control0.142857
belgium0.142857
LOWER IN switzerland0.142857
winter0.142857
china0.142857
LOWER IN mongolia0.142857
LOWER IN summer0.142857
anser cygnoides0.142857
bird0.142857
swan goose0.142857
LOWER IN estonia0.142857
female0.142857
rectum0.142857
LOWER IN finland0.142857
age0.142857
1-year-old human stage0.142857
LOWER IN 1-month-old human stage0.142857
kingdom of denmark0.142857

Problems / suggestions? Please email info AT dbbact DOT org