dbBact sequence annotation

Search result for sequence:

TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGACGGGTCGTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGATACTGGCGTCCTTGAGTACGGTTGAGGCAGGCGGAATTCGTGG

Taxonomy: dBacteria;p"Bacteroidetes";c"Bacteroidia";o"Bacteroidales";fBacteroidaceae;gBacteroides

species	# matches	SILVA IDs
bacteroides sp. marseille-p3208t	4	fqsc01000003, fqsc01000003, fqsc01000001, lt623890,

term enrichment score

Term	Score
LOWER IN days 14-28	0.285714
angus steer	0.285714
grey squirrel	0.285714
days 1-2	0.250000
post-weaning	0.250000
sciurus carolinensis	0.250000
LOWER IN forested area	0.200000
poland	0.200000
province of ontario	0.181818
belgium	0.153846
state of georgia	0.153846
LOWER IN switzerland	0.142857
rectum	0.125000
cow	0.125000
crohn's disease	0.105263
bos taurus	0.086957
city	0.074074
canada	0.057143
feces	0.028571
female	0.028169
adult	0.020942
homo sapiens	0.020408
LOWER IN control	0.010256
united states of america	0.007576

Fraction of dbbact annotations with this term covered by the query

Term	Score
LOWER IN days 14-28	0.500000
angus steer	0.500000
grey squirrel	0.500000
days 1-2	0.333333
post-weaning	0.333333
sciurus carolinensis	0.333333
LOWER IN forested area	0.200000
province of ontario	0.166667
poland	0.133333
belgium	0.125000
state of georgia	0.125000
LOWER IN switzerland	0.111111
rectum	0.090909
cow	0.090909
crohn's disease	0.071429
bos taurus	0.055556
city	0.045455
canada	0.033333
female	0.015152
feces	0.014493
adult	0.010753
homo sapiens	0.010381
LOWER IN control	0.005263
united states of america	0.003861

Fraction of annotations for the query sequences containing the term

Term	Score
feces	1.000000
homo sapiens	0.600000
poland	0.400000
adult	0.400000
crohn's disease	0.200000
LOWER IN control	0.200000
belgium	0.200000
LOWER IN switzerland	0.200000
female	0.200000
rectum	0.200000
days 1-2	0.200000
LOWER IN days 14-28	0.200000
united states of america	0.200000
bos taurus	0.200000
state of georgia	0.200000
cow	0.200000
post-weaning	0.200000
angus steer	0.200000
city	0.200000
LOWER IN forested area	0.200000
canada	0.200000
province of ontario	0.200000
sciurus carolinensis	0.200000
grey squirrel	0.200000

Exp. ID	User ID	Description	Date	Region	Flag	Sequences
398	amnon	high in crohn's disease compared to control in feces homo sapiens belgium	2018-11-15	v4	No	1 / 68
663	amnon	high in poland compared to switzerland in feces homo sapiens adult	2020-09-22	v4	No	1 / 72
310	amnon	common feces, homo sapiens, female, rectum, adult, poland	2018-04-07	v4	No	1 / 227
518	amnon	higher in beginning of experiment ( high in days 1-2 compared to days 14-28 in feces united states of america bos taurus state of georgia cow post-weaning angus steer )	2019-06-11	v4	No	1 / 325
906	amnon	high in city compared to forested area in feces canada province of ontario sciurus carolinensis grey squirrel	2022-05-19	v4	No	1 / 421

Taxonomy: d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__Bacteroides

Taxonomy: dBacteria;p"Bacteroidetes";c"Bacteroidia";o"Bacteroidales";fBacteroidaceae;gBacteroides