Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGACGGGTCGTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGATACTGGCGTCCTTGAGTACGGTTGAGGCAGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
LOWER IN days 14-280.285714
angus steer0.285714
grey squirrel0.285714
days 1-20.250000
post-weaning0.250000
sciurus carolinensis0.250000
LOWER IN forested area0.200000
poland0.200000
province of ontario0.181818
belgium0.153846
state of georgia0.153846
LOWER IN switzerland0.142857
rectum0.125000
cow0.125000
crohn's disease0.105263
bos taurus0.086957
city0.074074
canada0.057143
feces0.028571
female0.028169
adult0.020942
homo sapiens0.020408
LOWER IN control0.010256
united states of america0.007576
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN days 14-280.500000
angus steer0.500000
grey squirrel0.500000
days 1-20.333333
post-weaning0.333333
sciurus carolinensis0.333333
LOWER IN forested area0.200000
province of ontario0.166667
poland0.133333
belgium0.125000
state of georgia0.125000
LOWER IN switzerland0.111111
rectum0.090909
cow0.090909
crohn's disease0.071429
bos taurus0.055556
city0.045455
canada0.033333
female0.015152
feces0.014493
adult0.010753
homo sapiens0.010381
LOWER IN control0.005263
united states of america0.003861
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.600000
poland0.400000
adult0.400000
crohn's disease0.200000
LOWER IN control0.200000
belgium0.200000
LOWER IN switzerland0.200000
female0.200000
rectum0.200000
days 1-20.200000
LOWER IN days 14-280.200000
united states of america0.200000
bos taurus0.200000
state of georgia0.200000
cow0.200000
post-weaning0.200000
angus steer0.200000
city0.200000
LOWER IN forested area0.200000
canada0.200000
province of ontario0.200000
sciurus carolinensis0.200000
grey squirrel0.200000

Problems / suggestions? Please email info AT dbbact DOT org