Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGACGGGTCGTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGATACTGGCGTCCTTGAGTACGGTTGAGGCAGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
LOWER IN days 14-280.333333
angus steer0.333333
days 1-20.285714
post-weaning0.285714
poland0.235294
belgium0.166667
state of georgia0.166667
LOWER IN switzerland0.153846
rectum0.133333
cow0.133333
crohn's disease0.125000
bos taurus0.095238
female0.029851
feces0.025157
adult0.022599
homo sapiens0.021818
LOWER IN control0.010582
united states of america0.007968
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN days 14-280.500000
angus steer0.500000
days 1-20.333333
post-weaning0.333333
poland0.153846
belgium0.125000
state of georgia0.125000
LOWER IN switzerland0.111111
rectum0.090909
cow0.090909
crohn's disease0.083333
bos taurus0.058824
female0.015873
feces0.012739
adult0.011561
homo sapiens0.011070
LOWER IN control0.005405
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens0.750000
poland0.500000
adult0.500000
crohn's disease0.250000
LOWER IN control0.250000
belgium0.250000
LOWER IN switzerland0.250000
female0.250000
rectum0.250000
days 1-20.250000
LOWER IN days 14-280.250000
united states of america0.250000
bos taurus0.250000
state of georgia0.250000
cow0.250000
post-weaning0.250000
angus steer0.250000

Problems / suggestions? Please email info AT dbbact DOT org