Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGAACGGAAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGTCGTTCTAGAGTGGGCGAGAAGTATGCGGAATGCGTGGT
common ontology terms
term enrichment score
TermScore
nih 31m chow0.400000
caecum0.363636
c57bl/6j0.173913
LOWER IN high fat diet0.142857
mouse chow0.142857
mouse0.074074
diet0.074074
mus musculus0.065574
united states of america0.019802
research facility0.018018
feces0.017391
Fraction of dbbact annotations with this term covered by the query
TermScore
nih 31m chow0.500000
caecum0.250000
c57bl/6j0.100000
LOWER IN high fat diet0.090909
mouse chow0.090909
diet0.041667
mouse0.038462
mus musculus0.033898
united states of america0.010000
research facility0.009259
feces0.008772
Fraction of annotations for the query sequences containing the term
TermScore
mus musculus1.000000
mouse1.000000
feces1.000000
united states of america1.000000
caecum0.666667
c57bl/6j0.666667
research facility0.333333
diet0.333333
nih 31m chow0.333333
LOWER IN high fat diet0.333333
mouse chow0.333333

Problems / suggestions? Please email info AT dbbact DOT org