Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGAACGGAAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGTCGTTCTAGAGTGGGCGAGAAGTATGCGGAATGCGTGGT
common ontology terms
term enrichment score
TermScore
nih 31m chow0.400000
c57bl/6j0.173913
LOWER IN high fat diet0.153846
mouse chow0.153846
caecum0.085106
mouse0.078431
diet0.074074
mus musculus0.068966
united states of america0.021164
research facility0.020000
feces0.018957
Fraction of dbbact annotations with this term covered by the query
TermScore
nih 31m chow0.500000
c57bl/6j0.100000
LOWER IN high fat diet0.100000
mouse chow0.100000
caecum0.045455
diet0.041667
mouse0.040816
mus musculus0.035714
united states of america0.010695
research facility0.010309
feces0.009569
Fraction of annotations for the query sequences containing the term
TermScore
mus musculus1.000000
mouse1.000000
feces1.000000
united states of america1.000000
caecum0.666667
c57bl/6j0.666667
research facility0.333333
diet0.333333
nih 31m chow0.333333
LOWER IN high fat diet0.333333
mouse chow0.333333

Problems / suggestions? Please email info AT dbbact DOT org