Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGGCGGTTAAGTCAGCGGTGAAAGGCAGGGGCTCAACCCCGGCAGTGCCGTTGATACTGGCCGTCTTGAATGCGGTCGAGGCCGGCGGAATGTGGCG
common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
gorilla gorilla0.600000
saint louis zoo0.500000
saint louis0.500000
pan troglodytes0.500000
chimpanzee0.500000
gorilla0.500000
lincoln park zoo0.500000
como zoo0.500000
white-faced saki0.500000
pithecia pithecia0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
LOWER IN pan troglodytes troglodytes0.500000
gorilla gorilla gorilla0.500000
zoological garden0.363636
chicago0.333333
pongo abelii0.333333
sumatran orangutan0.333333
state of tennessee0.200000
state of minnesota0.166667
french republic0.142857
monkey0.111111
LOWER IN wild0.100000
feces0.016194
united states of america0.014218
Fraction of annotations for the query sequences containing the term
TermScore
zoological garden1.000000
feces1.000000
united states of america0.933333
pan troglodytes0.466667
chimpanzee0.466667
gorilla gorilla0.333333
saint louis zoo0.266667
saint louis0.266667
state of tennessee0.266667
lincoln park zoo0.133333
chicago0.133333
state of minnesota0.133333
como zoo0.133333
LOWER IN nouabale-ndoki national park0.133333
LOWER IN republic of congo0.133333
LOWER IN wild0.133333
french republic0.066667
monkey0.066667
gorilla0.066667
white-faced saki0.066667
pithecia pithecia0.066667
pongo abelii0.066667
sumatran orangutan0.066667
LOWER IN pan troglodytes troglodytes0.066667
gorilla gorilla gorilla0.066667
Exp. ID User ID Description Date Region Flag Sequences
620amnondominant saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 7
399amnondominant feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 10
620amnondominant saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 14
406amnondominant feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 14
620amnondominant lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 15
399amnondominant pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 15
625amnoncommon state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 178
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 357
399amnoncommon feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 394
399amnoncommon pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 406
625amnoncommon pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 413
620amnoncommon saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 432
620amnoncommon saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 529
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 963
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1018

Problems / suggestions? Please email info AT dbbact DOT org