Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCACGCCAAGTCAGCGGTGAAATTTCCGGGCTCAACCCGGAGTGTGCCGTTGAAACTGGCGAGCTAGAGTGCACAAGAGGCAGGCGGAATGCGTGG
common ontology terms
term enrichment score
TermScore
china0.222222
child0.159574
milan0.146341
homo sapiens0.142373
kingdom of spain0.133333
feces0.124260
adult0.111978
italy0.111111
soweto0.111111
urban community0.111111
nanning city prefecture0.111111
sixth decade human stage0.111111
city0.096774
egypt0.090909
thailand0.090909
broiler chicken0.086957
hiv infection0.076923
obsolete_juvenile stage0.076923
male0.073620
LOWER IN infant0.068966
south africa0.066667
chicken0.062500
bile0.060606
gallus gallus0.060606
lima0.060606
osteoarthritis0.058824
non-celiac gluten sensitivity0.058824
sigmoid colon brushing0.058824
pemba island0.058824
LOWER IN nephrolithiasis0.058824
gangcha region0.058824
LOWER IN gannan tibetan autonomous prefecture0.058824
gallbladder0.058824
cholelithiasis0.058824
age 8-120.058824
age 13-140.058824
LOWER IN age 3-60.058824
LOWER IN bushbuckridge local municipality0.058824
LOWER IN peri-urban community0.058824
new delhi0.058824
shantytown0.058824
LOWER IN el salado0.058824
soldiers0.058824
LOWER IN age >940.058824
LOWER IN tenth decade human stage0.058824
LOWER IN age 0-6 months0.058824
indonesia0.058824
municipality of yogyakarta0.058824
cron diet0.058824
bangui0.058824
LOWER IN antananarivo0.058824
madrid0.057143
colonic mucosa0.057143
tibet autonomous region0.057143
14-year-old human stage0.057143
human middle aged stage0.057143
LOWER IN viet nam0.057143
LOWER IN 65-79 year-old human stage0.057143
LOWER IN ninth decade human stage0.057143
LOWER IN american diet0.057143
central african republic0.057143
LOWER IN madagascar0.057143
sigmoid colon0.055556
LOWER IN age 1-3 years0.055556
tanzania0.055556
biopsy site0.055556
gay0.055556
formula fed0.055556
13-year-old human stage0.055556
LOWER IN gay0.055556
LOWER IN small village0.055556
LOWER IN fifth decade human stage0.055556
LOWER IN left colon0.055556
6-12 year-old child stage0.054054
heterosexual0.054054
msw0.054054
young adult stage0.054054
caloric restriction diet0.054054
jejunum0.054054
LOWER IN right colon0.054054
LOWER IN 2-year-old human stage0.052632
tibetan plateau0.052632
homosexual0.052632
msm0.052632
2-year-old human stage0.052632
LOWER IN small intestine0.052632
LOWER IN homosexual0.052632
LOWER IN msm0.052632
LOWER IN 12-month-old human stage0.051282
india0.051282
LOWER IN fourth decade human stage0.051282
belgium0.050000
czech republic0.050000
biopsy0.050000
ulcerative colitis0.050000
female0.047431
rural community0.046512
rectum0.046512
LOWER IN 2-5 year-old child stage0.046512
LOWER IN rural community0.046512
Fraction of dbbact annotations with this term covered by the query
TermScore
china1.000000
bile1.000000
lima1.000000
osteoarthritis0.500000
non-celiac gluten sensitivity0.500000
sigmoid colon brushing0.500000
soweto0.500000
urban community0.500000
pemba island0.500000
LOWER IN nephrolithiasis0.500000
nanning city prefecture0.500000
sixth decade human stage0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
gallbladder0.500000
cholelithiasis0.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
LOWER IN bushbuckridge local municipality0.500000
LOWER IN peri-urban community0.500000
new delhi0.500000
shantytown0.500000
LOWER IN el salado0.500000
soldiers0.500000
LOWER IN age >940.500000
LOWER IN tenth decade human stage0.500000
LOWER IN age 0-6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
cron diet0.500000
bangui0.500000
LOWER IN antananarivo0.500000
milan0.333333
madrid0.333333
colonic mucosa0.333333
tibet autonomous region0.333333
14-year-old human stage0.333333
human middle aged stage0.333333
LOWER IN viet nam0.333333
LOWER IN 65-79 year-old human stage0.333333
LOWER IN ninth decade human stage0.333333
LOWER IN american diet0.333333
central african republic0.333333
LOWER IN madagascar0.333333
sigmoid colon0.250000
LOWER IN age 1-3 years0.250000
tanzania0.250000
biopsy site0.250000
gay0.250000
formula fed0.250000
13-year-old human stage0.250000
LOWER IN gay0.250000
LOWER IN small village0.250000
LOWER IN fifth decade human stage0.250000
LOWER IN left colon0.250000
6-12 year-old child stage0.200000
heterosexual0.200000
msw0.200000
young adult stage0.200000
caloric restriction diet0.200000
jejunum0.200000
LOWER IN right colon0.200000
LOWER IN 2-year-old human stage0.166667
tibetan plateau0.166667
homosexual0.166667
msm0.166667
2-year-old human stage0.166667
egypt0.166667
LOWER IN small intestine0.166667
thailand0.166667
LOWER IN homosexual0.166667
LOWER IN msm0.166667
kingdom of spain0.142857
LOWER IN 12-month-old human stage0.142857
india0.142857
broiler chicken0.142857
LOWER IN fourth decade human stage0.142857
child0.138889
belgium0.125000
czech republic0.125000
biopsy0.125000
ulcerative colitis0.125000
italy0.100000
city0.100000
hiv infection0.100000
obsolete_juvenile stage0.100000
rural community0.090909
rectum0.090909
LOWER IN 2-5 year-old child stage0.090909
LOWER IN rural community0.090909
LOWER IN duodenum0.090909
2-5 year-old child stage0.090909
duodenum0.090909
south korea0.083333
crohn's disease0.083333
homo sapiens0.077491
LOWER IN infant0.076923
south africa0.071429
feces0.066879
Fraction of annotations for the query sequences containing the term
TermScore
feces0.875000
homo sapiens0.875000
adult0.468750
child0.187500
italy0.125000
kingdom of spain0.125000
china0.125000
milan0.093750
united states of america0.093750
male0.093750
female0.093750
city0.093750
south africa0.062500
soweto0.062500
urban community0.062500
control0.062500
nanning city prefecture0.062500
sixth decade human stage0.062500
hiv infection0.062500
LOWER IN infant0.062500
egypt0.062500
obsolete_juvenile stage0.062500
thailand0.062500
gallus gallus0.062500
chicken0.062500
broiler chicken0.062500
south korea0.031250
osteoarthritis0.031250
midwest region0.031250
human adult stage0.031250
non-celiac gluten sensitivity0.031250
LOWER IN female0.031250
madrid0.031250
crohn's disease0.031250
LOWER IN control0.031250
belgium0.031250
czech republic0.031250
colonic mucosa0.031250
sigmoid colon0.031250
sigmoid colon brushing0.031250
rural community0.031250
LOWER IN child0.031250
LOWER IN age 1-3 years0.031250
LOWER IN 2-year-old human stage0.031250
LOWER IN 1-year-old human stage0.031250
tanzania0.031250
pemba island0.031250
LOWER IN nephrolithiasis0.031250
gangcha region0.031250
LOWER IN gannan tibetan autonomous prefecture0.031250
tibetan plateau0.031250
tibet autonomous region0.031250
rectum0.031250
biopsy site0.031250
biopsy0.031250
LOWER IN feces0.031250
ulcerative colitis0.031250
LOWER IN sweden0.031250
gay0.031250
homosexual0.031250
msm0.031250
2-year-old human stage0.031250
LOWER IN 12-month-old human stage0.031250
germany0.031250
formula fed0.031250
LOWER IN united states of america0.031250
bile0.031250
gallbladder0.031250
cholelithiasis0.031250
age 8-120.031250
age 13-140.031250
6-12 year-old child stage0.031250
13-year-old human stage0.031250
14-year-old human stage0.031250
LOWER IN age 3-60.031250
LOWER IN 2-5 year-old child stage0.031250
LOWER IN rural community0.031250
LOWER IN bushbuckridge local municipality0.031250
LOWER IN peri-urban community0.031250
human middle aged stage0.031250
LOWER IN small intestine0.031250
LOWER IN duodenum0.031250
new delhi0.031250
india0.031250
LOWER IN viet nam0.031250
heterosexual0.031250
msw0.031250
LOWER IN gay0.031250
LOWER IN homosexual0.031250
LOWER IN msm0.031250
sweden0.031250
lima0.031250
shantytown0.031250
LOWER IN el salado0.031250
LOWER IN small village0.031250
soldiers0.031250
young adult stage0.031250
LOWER IN adult0.031250
LOWER IN age >940.031250
LOWER IN 65-79 year-old human stage0.031250
Exp. ID User ID Description Date Region Flag Sequences
851amnondominant feces, homo sapiens, adult, italy, milan2021-12-16v3No1 / 20
593amnondominant feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 22
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
843amnoncommon feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 59
851amnoncommon feces, homo sapiens, adult, italy, milan2021-12-16v3No1 / 62
630amnon high in male compared to female in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
851amnoncommon homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 71
861amnoncommon feces, homo sapiens, female, city, south africa, rural community, soweto, urban community2022-01-15v3No1 / 73
736amnon high in female adult compared to child age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 79
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 83
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
578amnon high in kingdom of spain compared to sweden in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 133
797amnon high in child 2-year-old human stage compared to infant 12-month-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
62amnon high in egypt compared to united states of america in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 144
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage compared to age 3-6 2-5 year-old child stage in feces homo sapiens china )2018-12-30v4No1 / 168
861amnon high in city soweto urban community compared to rural community bushbuckridge local municipality peri-urban community in feces homo sapiens female south africa human middle aged stage 2022-01-15v3No1 / 185
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
568amnon high in thailand compared to viet nam in feces gallus gallus chicken broiler chicken 2019-12-08v3No1 / 206
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in soldiers young adult stage compared to adult age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564

Problems / suggestions? Please email info AT dbbact DOT org