Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTGTTAAGTCAGCGGTGAAATCTTGGGGCTCAACCCCGAAACTGCCGTTGAAACTGGCGAGCTTGAGTGTAGATGAGGTAGGCGGAATTCGTGG
common ontology terms
term enrichment score
TermScore
tonsil0.555556
state of michigan0.363636
age 1-3 weeks0.352941
age 12-19 weeks0.266667
pig0.222222
sus scrofa0.222222
age 8 hours0.153846
age 6-10 weeks0.153846
LOWER IN age 6-10 weeks0.153846
nipple0.142857
LOWER IN age 4 weeks0.142857
age 4 weeks0.125000
farm0.108108
skin0.045455
united states of america0.016461
adult0.011928
Fraction of dbbact annotations with this term covered by the query
TermScore
age 1-3 weeks0.500000
age 8 hours0.500000
age 6-10 weeks0.500000
age 12-19 weeks0.500000
LOWER IN age 6-10 weeks0.500000
tonsil0.400000
nipple0.333333
LOWER IN age 4 weeks0.333333
state of michigan0.222222
age 4 weeks0.200000
pig0.125000
sus scrofa0.125000
farm0.057143
skin0.030303
united states of america0.008299
adult0.006098
Fraction of annotations for the query sequences containing the term
TermScore
pig1.000000
sus scrofa1.000000
united states of america1.000000
state of michigan1.000000
farm1.000000
tonsil0.909091
adult0.272727
age 1-3 weeks0.272727
age 12-19 weeks0.181818
age 8 hours0.090909
age 4 weeks0.090909
skin0.090909
nipple0.090909
age 6-10 weeks0.090909
LOWER IN age 4 weeks0.090909
LOWER IN age 6-10 weeks0.090909

Problems / suggestions? Please email info AT dbbact DOT org