Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCCAAGTCAGCGGTAAAAAAGCGGTGCTCAACGCCGTCGAGCCGTTGAAACTGGCGTTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGT
common ontology terms
term enrichment score
TermScore
canada0.409639
age 8 weeks0.340000
mouse0.328131
jackson laboratories0.326733
taconic farms0.309859
mus musculus0.294329
c57bl/60.276730
female0.197605
bodega bay0.169492
swiss webster0.169492
research facility0.166193
zostera marina0.156250
marine eelgrass0.156250
terminal ileum0.131148
high fat diet0.130719
state of oregon0.115942
right colon0.115942
ketogenic diet0.103448
caecum0.102128
ileum0.098765
age 4 weeks0.093750
feces0.080797
united states of america0.078118
ocean0.077519
cba/caj0.075472
LOWER IN terminal ileum0.075472
strain 129s0.075472
state of california0.069444
LOWER IN right colon0.067797
marine sediment0.065934
colon0.064000
control diet0.063492
LOWER IN ileum0.061538
c57bl/6j0.057971
mouse chow0.057971
diet0.054795
LOWER IN colon0.051948
sediment0.050847
LOWER IN age 9 weeks0.039216
age 9 weeks0.039216
strain s1290.039216
LOWER IN ecuador0.039216
LOWER IN harlan spague dawley0.039216
sea urchin0.039216
artificial seawater0.039216
nih 31m chow0.039216
LOWER IN c57bl/6j0.038462
metabolic syndrome0.038462
lytechinus variegatus0.038462
LOWER IN jackson laboratories0.037736
bolivia0.037736
urine0.037037
state of tennessee0.037037
kingdom of denmark0.036364
LOWER IN control diet0.035714
pregnancy0.035714
LOWER IN root0.034483
LOWER IN high fat diet0.033898
LOWER IN male0.033333
wild0.032787
state of florida0.032258
root0.032258
leaf0.029412
sea water0.025641
homo sapiens0.018519
adult0.015038
Fraction of dbbact annotations with this term covered by the query
TermScore
jackson laboratories0.600000
bodega bay0.500000
canada0.500000
taconic farms0.500000
swiss webster0.500000
cba/caj0.500000
LOWER IN age 9 weeks0.500000
LOWER IN terminal ileum0.500000
age 9 weeks0.500000
strain 129s0.500000
strain s1290.500000
LOWER IN ecuador0.500000
LOWER IN harlan spague dawley0.500000
sea urchin0.500000
artificial seawater0.500000
nih 31m chow0.500000
zostera marina0.333333
marine eelgrass0.333333
age 8 weeks0.333333
ketogenic diet0.333333
terminal ileum0.333333
LOWER IN c57bl/6j0.333333
metabolic syndrome0.333333
lytechinus variegatus0.333333
LOWER IN jackson laboratories0.250000
bolivia0.250000
mouse0.204082
c57bl/60.200000
state of oregon0.200000
age 4 weeks0.200000
right colon0.200000
LOWER IN right colon0.200000
urine0.200000
state of tennessee0.200000
high fat diet0.181818
mus musculus0.178571
female0.176471
kingdom of denmark0.166667
control diet0.142857
LOWER IN control diet0.142857
pregnancy0.142857
caecum0.136364
ileum0.125000
LOWER IN ileum0.125000
LOWER IN root0.111111
c57bl/6j0.100000
mouse chow0.100000
LOWER IN high fat diet0.100000
research facility0.092784
LOWER IN male0.090909
diet0.083333
wild0.083333
state of florida0.076923
root0.076923
marine sediment0.071429
LOWER IN colon0.071429
ocean0.062500
state of california0.052632
colon0.052632
leaf0.052632
sediment0.043478
feces0.043062
united states of america0.042781
sea water0.034483
homo sapiens0.011976
adult0.011905
Fraction of annotations for the query sequences containing the term
TermScore
mus musculus0.836735
mouse0.836735
research facility0.795918
feces0.653061
c57bl/60.448980
united states of america0.448980
age 8 weeks0.346939
canada0.346939
female0.224490
taconic farms0.224490
jackson laboratories0.224490
state of california0.102041
bodega bay0.102041
ocean0.102041
zostera marina0.102041
marine eelgrass0.102041
swiss webster0.102041
high fat diet0.102041
state of oregon0.081633
caecum0.081633
colon0.081633
right colon0.081633
ileum0.081633
terminal ileum0.081633
sediment0.061224
marine sediment0.061224
age 4 weeks0.061224
ketogenic diet0.061224
control diet0.040816
cba/caj0.040816
c57bl/6j0.040816
LOWER IN colon0.040816
LOWER IN right colon0.040816
LOWER IN ileum0.040816
LOWER IN terminal ileum0.040816
diet0.040816
strain 129s0.040816
mouse chow0.040816
homo sapiens0.040816
LOWER IN age 9 weeks0.020408
LOWER IN male0.020408
age 9 weeks0.020408
LOWER IN control diet0.020408
LOWER IN jackson laboratories0.020408
strain s1290.020408
LOWER IN c57bl/6j0.020408
urine0.020408
pregnancy0.020408
state of tennessee0.020408
wild0.020408
bolivia0.020408
LOWER IN ecuador0.020408
LOWER IN harlan spague dawley0.020408
kingdom of denmark0.020408
metabolic syndrome0.020408
adult0.020408
sea urchin0.020408
lytechinus variegatus0.020408
state of florida0.020408
artificial seawater0.020408
sea water0.020408
root0.020408
nih 31m chow0.020408
LOWER IN high fat diet0.020408
leaf0.020408
LOWER IN root0.020408
Exp. ID User ID Description Date Region Flag Sequences
236amnonhighfreq state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 5
435amnonhighfreq mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 7
538amnonhighfreq mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 11
538amnonhighfreq mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 12
405amnonhighfreq mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
458amnonhigh freq. in mice strains from jackson laboratories (highfreq mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 14
405amnonhighfreq mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
456amnonhighfreq mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 15
211amnonHigh freq. in multiple mouse strains feces (highfreq mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 16
538amnonhighfreq mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 17
538amnonhighfreq mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v4No1 / 18
538amnonhighfreq mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 18
188amnonhighfreq mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 20
124amnonhighfreq mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 21
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 22
538amnonhighfreq mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v4No1 / 22
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 23
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 25
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 27
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 30
211amnonCommon in multiple mouse strains feces (common mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 68
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 89
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v4No1 / 95
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 108
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 130
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 132
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 148
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v4No1 / 182
188amnoncommon mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 185
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v4No1 / 186
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
386amnon high in bolivia compared to ecuador in mouse mus musculus caecum wild 2018-10-28v4No1 / 246
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 267
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 483
214amnon high in diet nih 31m chow mouse chow compared to high fat diet in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 495
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, leaf2017-11-07v4No1 / 505
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745

Problems / suggestions? Please email info AT dbbact DOT org