Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCCAAGTCAGCGGTAAAAAAGCGGTGCTCAACGCCGTCGAGCCGTTGAAACTGGCGTTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGT
common ontology terms
term enrichment score
TermScore
jackson laboratories0.433735
mouse0.339332
c57bl/60.337209
age 8 weeks0.317757
canada0.317757
mus musculus0.306265
taconic farms0.282051
female0.172549
high fat diet0.166667
state of georgia0.166667
research facility0.166425
bodega bay0.151515
swiss webster0.151515
zostera marina0.140845
marine eelgrass0.140845
mouse chow0.134831
caecum0.130435
low fat diet0.117647
terminal ileum0.117647
state of oregon0.105263
right colon0.105263
ketogenic diet0.092308
ileum0.086957
age 4 weeks0.084507
united states of america0.082805
feces0.082522
ocean0.073529
cba/caj0.066667
LOWER IN terminal ileum0.066667
strain 129s0.066667
state of california0.066225
marine sediment0.061224
colon0.060606
LOWER IN right colon0.060606
LOWER IN high fat diet0.059701
control diet0.055556
LOWER IN ileum0.054054
c57bl/6j0.052632
diet0.050000
sediment0.048000
LOWER IN colon0.047619
LOWER IN age 9 weeks0.034483
age 9 weeks0.034483
LOWER IN high fat diet + inulin0.034483
high fat diet + inulin0.034483
strain s1290.034483
LOWER IN ecuador0.034483
LOWER IN harlan spague dawley0.034483
sea urchin0.034483
artificial seawater0.034483
nih 31m chow0.034483
LOWER IN male0.033898
LOWER IN c57bl/6j0.033898
metabolic syndrome0.033898
lytechinus variegatus0.033898
LOWER IN jackson laboratories0.033333
bolivia0.033333
urine0.032787
state of tennessee0.032787
kingdom of denmark0.031746
LOWER IN control diet0.031250
pregnancy0.031250
LOWER IN root0.029851
state of florida0.028169
root0.028169
wild0.027397
leaf0.026316
sea water0.023529
homo sapiens0.016878
adult0.012987
Fraction of dbbact annotations with this term covered by the query
TermScore
caecum0.750000
jackson laboratories0.666667
bodega bay0.500000
taconic farms0.500000
swiss webster0.500000
cba/caj0.500000
LOWER IN age 9 weeks0.500000
LOWER IN terminal ileum0.500000
age 9 weeks0.500000
LOWER IN high fat diet + inulin0.500000
high fat diet + inulin0.500000
strain 129s0.500000
strain s1290.500000
LOWER IN ecuador0.500000
LOWER IN harlan spague dawley0.500000
sea urchin0.500000
artificial seawater0.500000
nih 31m chow0.500000
zostera marina0.333333
marine eelgrass0.333333
age 8 weeks0.333333
canada0.333333
ketogenic diet0.333333
low fat diet0.333333
terminal ileum0.333333
LOWER IN male0.333333
LOWER IN c57bl/6j0.333333
metabolic syndrome0.333333
lytechinus variegatus0.333333
c57bl/60.250000
high fat diet0.250000
state of georgia0.250000
LOWER IN jackson laboratories0.250000
bolivia0.250000
mouse0.211538
state of oregon0.200000
age 4 weeks0.200000
right colon0.200000
LOWER IN right colon0.200000
urine0.200000
state of tennessee0.200000
mus musculus0.186441
mouse chow0.181818
LOWER IN high fat diet0.181818
female0.153846
kingdom of denmark0.142857
control diet0.125000
LOWER IN control diet0.125000
pregnancy0.125000
ileum0.111111
LOWER IN ileum0.111111
c57bl/6j0.100000
research facility0.092593
LOWER IN root0.090909
diet0.083333
marine sediment0.071429
LOWER IN colon0.071429
state of florida0.066667
root0.066667
ocean0.062500
wild0.058824
state of california0.052632
colon0.052632
leaf0.050000
united states of america0.045000
feces0.043860
sediment0.043478
sea water0.034483
homo sapiens0.011050
adult0.010204
Fraction of annotations for the query sequences containing the term
TermScore
mus musculus0.857143
mouse0.857143
research facility0.821429
feces0.696429
c57bl/60.517857
united states of america0.517857
jackson laboratories0.321429
age 8 weeks0.303571
canada0.303571
female0.196429
taconic farms0.196429
high fat diet0.125000
state of georgia0.125000
mouse chow0.107143
state of california0.089286
bodega bay0.089286
ocean0.089286
zostera marina0.089286
marine eelgrass0.089286
swiss webster0.089286
state of oregon0.071429
caecum0.071429
low fat diet0.071429
colon0.071429
right colon0.071429
ileum0.071429
terminal ileum0.071429
sediment0.053571
marine sediment0.053571
age 4 weeks0.053571
ketogenic diet0.053571
control diet0.035714
cba/caj0.035714
c57bl/6j0.035714
LOWER IN colon0.035714
LOWER IN right colon0.035714
LOWER IN ileum0.035714
LOWER IN terminal ileum0.035714
diet0.035714
LOWER IN high fat diet0.035714
strain 129s0.035714
homo sapiens0.035714
LOWER IN age 9 weeks0.017857
LOWER IN male0.017857
age 9 weeks0.017857
LOWER IN high fat diet + inulin0.017857
high fat diet + inulin0.017857
LOWER IN control diet0.017857
LOWER IN jackson laboratories0.017857
strain s1290.017857
LOWER IN c57bl/6j0.017857
urine0.017857
pregnancy0.017857
state of tennessee0.017857
wild0.017857
bolivia0.017857
LOWER IN ecuador0.017857
LOWER IN harlan spague dawley0.017857
kingdom of denmark0.017857
metabolic syndrome0.017857
adult0.017857
sea urchin0.017857
lytechinus variegatus0.017857
state of florida0.017857
artificial seawater0.017857
sea water0.017857
root0.017857
nih 31m chow0.017857
leaf0.017857
LOWER IN root0.017857
Exp. ID User ID Description Date Region Flag Sequences
236amnondominant state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 5
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 7
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 11
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 12
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
458amnonhigh freq. in mice strains from jackson laboratories (dominant mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 14
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 15
211amnonHigh freq. in multiple mouse strains feces (dominant mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 16
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 16
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 17
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 17
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v4No1 / 18
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 18
188amnondominant mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 20
124amnondominant mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 21
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 22
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v4No1 / 22
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 23
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 25
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 27
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 30
589amnon high in mouse chow low fat diet compared to high fat diet + inulin in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 51
211amnonCommon in multiple mouse strains feces (common mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 68
589amnon high in mouse chow low fat diet compared to high fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 74
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 78
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 89
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v4No1 / 95
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 108
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 130
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 132
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 148
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 151
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 172
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v4No1 / 182
188amnoncommon mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 185
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v4No1 / 186
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
386amnon high in bolivia compared to ecuador in mouse mus musculus caecum wild 2018-10-28v4No1 / 246
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 267
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 483
214amnon high in diet nih 31m chow mouse chow compared to high fat diet in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 495
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, leaf2017-11-07v4No1 / 505
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745

Problems / suggestions? Please email info AT dbbact DOT org