Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGTTAAGTCAGCGGTTAAATAGTGTAGCTCAACTATACTTTGCCGTTGAAACTGGCGTTCTTGAGTGTAAACGAGGTAGGCGGAATGTGACGT
common ontology terms
term enrichment score
TermScore
equus caballus0.578313
horse0.444444
state of texas0.320000
equus zebra0.181818
mountain zebra0.181818
LOWER IN cecal content0.181818
LOWER IN equine grass sickness0.181818
LOWER IN equus przewalskii0.181818
LOWER IN metronidazole0.153846
caecum0.153846
LOWER IN disease0.153846
united kingdom0.148148
cecal content0.142857
french republic0.125000
zoological garden0.105263
LOWER IN caecum0.095238
farm0.061538
feces0.034409
control0.027211
adult0.019950
united states of america0.019646
research facility0.018141
Fraction of dbbact annotations with this term covered by the query
TermScore
equus zebra0.500000
mountain zebra0.500000
LOWER IN cecal content0.500000
LOWER IN equine grass sickness0.500000
LOWER IN equus przewalskii0.500000
equus caballus0.428571
horse0.333333
LOWER IN metronidazole0.250000
state of texas0.250000
caecum0.250000
LOWER IN disease0.250000
cecal content0.200000
french republic0.142857
united kingdom0.111111
zoological garden0.100000
LOWER IN caecum0.083333
farm0.035714
feces0.017544
control0.014184
adult0.010204
united states of america0.010000
research facility0.009259
Fraction of annotations for the query sequences containing the term
TermScore
equus caballus0.888889
feces0.888889
horse0.666667
united states of america0.555556
adult0.444444
state of texas0.444444
research facility0.444444
control0.333333
farm0.222222
united kingdom0.222222
zoological garden0.111111
french republic0.111111
equus zebra0.111111
mountain zebra0.111111
LOWER IN metronidazole0.111111
LOWER IN caecum0.111111
LOWER IN cecal content0.111111
caecum0.111111
cecal content0.111111
LOWER IN equine grass sickness0.111111
LOWER IN disease0.111111
LOWER IN equus przewalskii0.111111

Problems / suggestions? Please email info AT dbbact DOT org