Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGCTTTTAAGTCAGCGGTAAAAATTCGGGGCTCAACCCCGTCCGGCCGTTGAAACTGGGGGCCTTGAGTGGGCGAGAAGAAGGCGGAATGCGTGGT
common ontology terms
term enrichment score
TermScore
mus musculus0.707902
mouse0.668954
research facility0.463960
caecum0.319249
male0.310345
c57bl/60.299501
feces0.240114
high fat diet0.202410
united states of america0.188459
female0.142466
mouse chow0.138408
c57bl/6j0.128342
balb/c0.125000
colon0.116129
israel0.109091
japan0.102564
rat0.100840
sweden0.093750
germany0.087591
texas0.084746
janvier labs0.075472
c57bl/6ncrl0.075472
control diet0.073620
charles river laboratories0.072727
obesity0.072727
jackson laboratories0.072727
rattus norvegicus0.068966
wild0.064516
finland0.063492
LOWER IN c57bl/6j0.058537
age 18 weeks0.057692
high sugar diet0.057692
swiss webster0.057692
age 9 months0.057692
canada0.056075
sprague dawley0.053812
cecal content0.053097
control0.050209
united kingdom0.048000
ldlr-0.039216
obese body mass index status0.039216
db/db mouse0.039216
house mice0.039216
state of iowa0.039216
cf-10.039216
fvb/n mice0.039216
mouse strain c57bc/6ncrl0.039216
no stress: single housed control0.039216
LOWER IN stress: chronic subordinate colony housing0.039216
wild type genotype0.039216
nzb/w f10.039216
harlan sprague dawley0.039216
dahl salt-sensitive0.039216
gastrointestinal system0.038835
western diet0.038462
state of washington0.038462
low fat diet0.038462
LOWER IN colitis0.038462
rattus0.038462
LOWER IN early timepoints0.038095
bolivia0.037736
ecuador0.037736
new york city0.037736
state of georgia0.037736
LOWER IN stomach0.037736
LOWER IN duodenum0.037736
LOWER IN ileum0.037383
south korea0.037037
switzerland0.036364
LOWER IN mouse chow0.036036
diet0.035294
brazil0.031250
city0.029851
LOWER IN control0.025210
china0.023346
no fructose diet0.020000
c3h/hej0.020000
chagas disease0.020000
LOWER IN ovariectomy0.020000
LOWER IN ovariectomized female0.020000
pulsed antibiotic treatment, macrolide tylosin tartrate0.020000
mus musculoides0.020000
nyulmc0.020000
nod/shiltj (no. 001976, jackson labs)0.020000
immunization0.020000
immunization mycobacterium vaccae0.020000
transverse colon0.020000
LOWER IN experimental cerebral malaria0.020000
LOWER IN malaria0.020000
cast/eij0.020000
LOWER IN diet induced metabolic disease0.020000
no immunization: vehicle as control0.020000
LOWER IN age 6 weeks0.020000
state of rhode island0.020000
scallion0.020000
LOWER IN polga mutant0.020000
strain s1290.020000
LOWER IN dss induced colitis0.020000
LOWER IN trichuris muris0.020000
polydextrose0.020000
Fraction of dbbact annotations with this term covered by the query
TermScore
caecum2.000000
male1.000000
LOWER IN c57bl/6j0.666667
mus musculus0.593220
high fat diet0.583333
mouse0.576923
c57bl/60.562500
janvier labs0.500000
age 18 weeks0.500000
high sugar diet0.500000
no fructose diet0.500000
ldlr-0.500000
swiss webster0.500000
obese body mass index status0.500000
db/db mouse0.500000
c3h/hej0.500000
chagas disease0.500000
house mice0.500000
c57bl/6ncrl0.500000
state of iowa0.500000
cf-10.500000
balb/c0.500000
fvb/n mice0.500000
age 9 months0.500000
LOWER IN ovariectomy0.500000
LOWER IN ovariectomized female0.500000
pulsed antibiotic treatment, macrolide tylosin tartrate0.500000
mus musculoides0.500000
nyulmc0.500000
nod/shiltj (no. 001976, jackson labs)0.500000
mouse strain c57bc/6ncrl0.500000
immunization0.500000
immunization mycobacterium vaccae0.500000
no stress: single housed control0.500000
LOWER IN stress: chronic subordinate colony housing0.500000
transverse colon0.500000
LOWER IN experimental cerebral malaria0.500000
LOWER IN malaria0.500000
cast/eij0.500000
LOWER IN diet induced metabolic disease0.500000
no immunization: vehicle as control0.500000
LOWER IN age 6 weeks0.500000
state of rhode island0.500000
scallion0.500000
wild type genotype0.500000
LOWER IN polga mutant0.500000
strain s1290.500000
LOWER IN dss induced colitis0.500000
LOWER IN trichuris muris0.500000
nzb/w f10.500000
polydextrose0.500000
high fat diet + polydextrose0.500000
harlan sprague dawley0.500000
LOWER IN high fat diet + polydextrose0.500000
LOWER IN polydextrose0.500000
strain 129s0.500000
dahl salt-sensitive0.500000
salt rich diet0.500000
salt0.500000
latetimepoints0.500000
age 23-33 weeks0.500000
LOWER IN 10-18 weeks0.500000
polga mutant0.500000
age 28 days0.500000
LOWER IN age 21 days0.500000
LOWER IN pre-weaning0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
LOWER IN esophagus0.500000
sea urchin0.500000
artificial seawater0.500000
heavy metal0.500000
LOWER IN dnbs induced colitis0.500000
mouse chow0.454545
gastrointestinal system0.400000
control diet0.375000
charles river laboratories0.333333
western diet0.333333
state of washington0.333333
obesity0.333333
jackson laboratories0.333333
canada0.333333
LOWER IN male0.333333
LOWER IN jejunum0.333333
caloric restriction diet0.333333
low fat diet0.333333
lean body mass0.333333
south america0.333333
low altitude0.333333
LOWER IN high altitude0.333333
age 6 weeks0.333333
LOWER IN colitis0.333333
LOWER IN parasitic helminthiasis infectious disease0.333333
ketogenic diet0.333333
systemic lupus erythematosus0.333333
post-weaning0.333333
metabolic syndrome0.333333
lytechinus variegatus0.333333
Fraction of annotations for the query sequences containing the term
TermScore
mus musculus0.877551
research facility0.816327
mouse0.795918
feces0.704082
united states of america0.438776
c57bl/60.204082
male0.183673
caecum0.173469
female0.132653
high fat diet0.122449
colon0.091837
c57bl/6j0.081633
mouse chow0.081633
wild0.071429
japan0.071429
balb/c0.071429
israel0.071429
germany0.061224
sweden0.061224
control0.061224
rat0.061224
texas0.051020
janvier labs0.040816
charles river laboratories0.040816
control diet0.040816
obesity0.040816
jackson laboratories0.040816
c57bl/6ncrl0.040816
finland0.040816
rattus norvegicus0.040816
age 18 weeks0.030612
high sugar diet0.030612
swiss webster0.030612
LOWER IN control0.030612
china0.030612
canada0.030612
age 9 months0.030612
cecal content0.030612
LOWER IN c57bl/6j0.030612
diet0.030612
united kingdom0.030612
sprague dawley0.030612
bolivia0.020408
ecuador0.020408
western diet0.020408
ldlr-0.020408
state of washington0.020408
obese body mass index status0.020408
db/db mouse0.020408
house mice0.020408
new york city0.020408
city0.020408
brazil0.020408
state of georgia0.020408
state of iowa0.020408
cf-10.020408
fvb/n mice0.020408
mouse strain c57bc/6ncrl0.020408
no stress: single housed control0.020408
LOWER IN stress: chronic subordinate colony housing0.020408
LOWER IN early timepoints0.020408
gastrointestinal system0.020408
LOWER IN stomach0.020408
LOWER IN duodenum0.020408
LOWER IN ileum0.020408
switzerland0.020408
LOWER IN mouse chow0.020408
low fat diet0.020408
wild type genotype0.020408
LOWER IN colitis0.020408
nzb/w f10.020408
harlan sprague dawley0.020408
dahl salt-sensitive0.020408
south korea0.020408
rattus0.020408
no fructose diet0.010204
LOWER IN fructose diet0.010204
LOWER IN fructose0.010204
LOWER IN caecum0.010204
c3h/hej0.010204
chagas disease0.010204
LOWER IN ovariectomy0.010204
LOWER IN ovariectomized female0.010204
pulsed antibiotic treatment, macrolide tylosin tartrate0.010204
antibiotic0.010204
mus musculoides0.010204
nyulmc0.010204
nod/shiltj (no. 001976, jackson labs)0.010204
immunization0.010204
immunization mycobacterium vaccae0.010204
fasting0.010204
late timepoints0.010204
LOWER IN male0.010204
right colon0.010204
transverse colon0.010204
left colon0.010204
LOWER IN jejunum0.010204
caloric restriction diet0.010204
LOWER IN normal diet0.010204
early time points0.010204
Exp. ID User ID Description Date Region Flag Sequences
386amnondominant mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 11
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 11
108amnon high in colon compared to caecum in research facility texas united states of america mus musculus mouse 2017-04-07v4No1 / 13
386amnondominant mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 14
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 14
326amnondominant mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 15
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 15
212amnondominant mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 17
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (dominant mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 17
386amnondominant mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 17
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 17
39amnonhigh freq. in obsese lepr-db mice (dominant mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 18
216amnondominant mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 19
503amnondominant mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 19
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 20
476amnondominant mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 20
124amnondominant mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 21
503amnondominant mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 21
248amnondominant mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 22
334amnondominant mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 22
611amnon high in control compared to ovariectomy ovariectomized female in mouse mus musculus canada research facility age 9 months cecal content caecum female 2020-04-21v4No1 / 22
108amnondominant research facility, texas, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 25
46amnonsmj: higher in mice feces treated with antibiotics ( high in pulsed antibiotic treatment, macrolide tylosin tartrate antibiotic compared to control in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 28
47amnonsmj: lower in bullied immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america mus musculus male mouse strain c57bc/6ncrl research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 28
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america colon mus musculus mouse )2017-04-07v4No1 / 31
611amnon high in female compared to male in mouse mus musculus canada research facility age 9 months cecal content caecum 2020-04-21v4No1 / 33
14amnon high in caecum right colon transverse colon left colon feces compared to stomach duodenum jejunum ileum in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 51
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 58
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 58
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in mus musculus mouse feces united states of america )2017-04-14v4No1 / 63
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america mus musculus male mouse strain c57bc/6ncrl research facility no immunization: vehicle as control )2017-01-13v4No1 / 70
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 81
386amnoncommon mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 90
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
326amnoncommon mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 122
386amnonnegatively correlated with altitude (0-4km) in house mouse caecum ( high in low altitude compared to high altitude in mouse mus musculus caecum wild south america )2018-10-28v4No1 / 122
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 126
386amnoncommon mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 129
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 130
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 139
611amnoncommon mouse, mus musculus, canada, research facility, age 9 months, cecal content, caecum2020-04-21v4No1 / 145
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 148
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 153
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 155
108amnoncommon research facility, texas, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 158
368amnoncommon feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 161
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 161
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 167
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 172
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 184
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 186
386amnoncommon mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 189
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 207
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 210
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 224
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
108amnoncommon research facility, texas, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v4No1 / 241
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
503amnoncommon mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 257
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 265
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v4No1 / 287
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 297
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 299
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
13amnon high in caecum colon rectum feces compared to esophagus stomach duodenum ileum mouth in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 316
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 407
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754

Problems / suggestions? Please email info AT dbbact DOT org