Search result for sequence:
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGCTTTTAAGTCAGCGGTAAAAATTCGGGGCTCAACCCCGTCCGGCCGTTGAAACTGGGGGCCTTGAGTGGGCGAGAAGAAGGCGGAATGCGTGGT
common ontology terms
term enrichment score
TermScore
mus musculus0.709113
mouse0.667429
research facility0.467527
male0.329897
c57bl/60.288577
feces0.245642
caecum0.207407
united states of america0.193238
high fat diet0.182927
mouse chow0.149533
c57bl/6j0.135977
balb/c0.133333
female0.132690
colon0.121622
japan0.108108
sweden0.101695
germany0.096774
texas0.090090
israel0.086207
janvier labs0.080808
c57bl/6ncrl0.080808
wild0.080000
charles river laboratories0.077670
obesity0.077670
rat0.074766
finland0.067227
LOWER IN c57bl/6j0.062827
age 18 weeks0.061856
high sugar diet0.061856
swiss webster0.061856
control diet0.059113
united kingdom0.050847
control0.045455
ldlr-0.042105
obese body mass index status0.042105
db/db mouse0.042105
house mice0.042105
state of iowa0.042105
cf-10.042105
fvb/n mice0.042105
mouse strain c57bc/6ncrl0.042105
no stress: single housed control0.042105
LOWER IN stress: chronic subordinate colony housing0.042105
gastrointestinal system0.042105
low fat diet0.042105
wild type genotype0.042105
nzb/w f10.042105
harlan sprague dawley0.042105
dahl salt-sensitive0.042105
western diet0.041237
state of washington0.041237
LOWER IN colitis0.041237
rattus0.041237
LOWER IN early timepoints0.040816
LOWER IN stomach0.040816
bolivia0.040404
ecuador0.040404
new york city0.040404
LOWER IN duodenum0.040404
LOWER IN ileum0.040404
switzerland0.040404
jackson laboratories0.039604
south korea0.039604
LOWER IN mouse chow0.038835
rattus norvegicus0.038095
diet0.036810
brazil0.033613
city0.032000
LOWER IN control0.027397
china0.026374
no fructose diet0.021505
c3h/hej0.021505
chagas disease0.021505
pulsed antibiotic treatment, macrolide tylosin tartrate0.021505
mus musculoides0.021505
nyulmc0.021505
nod/shiltj (no. 001976, jackson labs)0.021505
immunization0.021505
immunization mycobacterium vaccae0.021505
transverse colon0.021505
LOWER IN experimental cerebral malaria0.021505
LOWER IN malaria0.021505
cast/eij0.021505
LOWER IN diet induced metabolic disease0.021505
no immunization: vehicle as control0.021505
LOWER IN age 6 weeks0.021505
state of rhode island0.021505
scallion0.021505
LOWER IN polga mutant0.021505
strain s1290.021505
LOWER IN dss induced colitis0.021505
LOWER IN trichuris muris0.021505
polydextrose0.021505
high fat diet + polydextrose0.021505
LOWER IN high fat diet + polydextrose0.021505
LOWER IN polydextrose0.021505
strain 129s0.021505
salt rich diet0.021505
salt0.021505
latetimepoints0.021505
Fraction of dbbact annotations with this term covered by the query
TermScore
male2.666667
LOWER IN c57bl/6j0.666667
mus musculus0.589286
mouse0.571429
high fat diet0.545455
c57bl/60.533333
janvier labs0.500000
age 18 weeks0.500000
high sugar diet0.500000
no fructose diet0.500000
ldlr-0.500000
swiss webster0.500000
mouse chow0.500000
obese body mass index status0.500000
db/db mouse0.500000
c3h/hej0.500000
chagas disease0.500000
house mice0.500000
c57bl/6ncrl0.500000
state of iowa0.500000
cf-10.500000
balb/c0.500000
fvb/n mice0.500000
pulsed antibiotic treatment, macrolide tylosin tartrate0.500000
mus musculoides0.500000
nyulmc0.500000
nod/shiltj (no. 001976, jackson labs)0.500000
mouse strain c57bc/6ncrl0.500000
immunization0.500000
immunization mycobacterium vaccae0.500000
no stress: single housed control0.500000
LOWER IN stress: chronic subordinate colony housing0.500000
gastrointestinal system0.500000
transverse colon0.500000
LOWER IN experimental cerebral malaria0.500000
LOWER IN malaria0.500000
cast/eij0.500000
LOWER IN diet induced metabolic disease0.500000
no immunization: vehicle as control0.500000
LOWER IN age 6 weeks0.500000
low fat diet0.500000
state of rhode island0.500000
scallion0.500000
wild type genotype0.500000
LOWER IN polga mutant0.500000
strain s1290.500000
LOWER IN dss induced colitis0.500000
LOWER IN trichuris muris0.500000
nzb/w f10.500000
polydextrose0.500000
high fat diet + polydextrose0.500000
harlan sprague dawley0.500000
LOWER IN high fat diet + polydextrose0.500000
LOWER IN polydextrose0.500000
strain 129s0.500000
dahl salt-sensitive0.500000
salt rich diet0.500000
salt0.500000
latetimepoints0.500000
age 23-33 weeks0.500000
LOWER IN 10-18 weeks0.500000
polga mutant0.500000
age 28 days0.500000
LOWER IN age 21 days0.500000
LOWER IN pre-weaning0.500000
nanger granti0.500000
kenya0.500000
tropical grassland biome0.500000
gazelle0.500000
LOWER IN esophagus0.500000
sea urchin0.500000
artificial seawater0.500000
heavy metal0.500000
LOWER IN dnbs induced colitis0.500000
LOWER IN fructose diet0.333333
LOWER IN fructose0.333333
charles river laboratories0.333333
western diet0.333333
state of washington0.333333
obesity0.333333
LOWER IN jejunum0.333333
caloric restriction diet0.333333
lean body mass0.333333
south america0.333333
low altitude0.333333
LOWER IN high altitude0.333333
age 6 weeks0.333333
LOWER IN colitis0.333333
LOWER IN parasitic helminthiasis infectious disease0.333333
ketogenic diet0.333333
systemic lupus erythematosus0.333333
post-weaning0.333333
metabolic syndrome0.333333
lytechinus variegatus0.333333
rattus0.333333
wistar rat0.333333
research facility0.329897
caecum0.318182
c57bl/6j0.300000
control diet0.285714
Fraction of annotations for the query sequences containing the term
TermScore
mus musculus0.890110
mouse0.802198
research facility0.802198
feces0.714286
united states of america0.450549
c57bl/60.197802
male0.175824
caecum0.153846
female0.120879
high fat diet0.109890
colon0.098901
c57bl/6j0.087912
mouse chow0.087912
wild0.076923
japan0.076923
balb/c0.076923
germany0.065934
sweden0.065934
texas0.054945
israel0.054945
control0.054945
janvier labs0.043956
charles river laboratories0.043956
obesity0.043956
c57bl/6ncrl0.043956
finland0.043956
rat0.043956
age 18 weeks0.032967
high sugar diet0.032967
swiss webster0.032967
control diet0.032967
LOWER IN control0.032967
china0.032967
LOWER IN c57bl/6j0.032967
diet0.032967
united kingdom0.032967
bolivia0.021978
ecuador0.021978
western diet0.021978
ldlr-0.021978
state of washington0.021978
obese body mass index status0.021978
db/db mouse0.021978
house mice0.021978
new york city0.021978
city0.021978
brazil0.021978
state of iowa0.021978
cf-10.021978
fvb/n mice0.021978
mouse strain c57bc/6ncrl0.021978
no stress: single housed control0.021978
LOWER IN stress: chronic subordinate colony housing0.021978
LOWER IN early timepoints0.021978
gastrointestinal system0.021978
LOWER IN stomach0.021978
LOWER IN duodenum0.021978
LOWER IN ileum0.021978
switzerland0.021978
LOWER IN mouse chow0.021978
low fat diet0.021978
wild type genotype0.021978
jackson laboratories0.021978
LOWER IN colitis0.021978
nzb/w f10.021978
harlan sprague dawley0.021978
rattus norvegicus0.021978
dahl salt-sensitive0.021978
south korea0.021978
rattus0.021978
no fructose diet0.010989
LOWER IN fructose diet0.010989
LOWER IN fructose0.010989
LOWER IN caecum0.010989
c3h/hej0.010989
chagas disease0.010989
pulsed antibiotic treatment, macrolide tylosin tartrate0.010989
antibiotic0.010989
mus musculoides0.010989
nyulmc0.010989
nod/shiltj (no. 001976, jackson labs)0.010989
immunization0.010989
immunization mycobacterium vaccae0.010989
fasting0.010989
late timepoints0.010989
right colon0.010989
transverse colon0.010989
left colon0.010989
LOWER IN jejunum0.010989
caloric restriction diet0.010989
LOWER IN normal diet0.010989
early time points0.010989
LOWER IN late time points0.010989
LOWER IN experimental cerebral malaria0.010989
LOWER IN malaria0.010989
cast/eij0.010989
LOWER IN diet induced metabolic disease0.010989
no immunization: vehicle as control0.010989
LOWER IN age 6 weeks0.010989
LOWER IN high fat diet0.010989
Exp. ID User ID Description Date Region Flag Sequences
386amnonhighfreq mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 11
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 11
108amnon high in colon compared to caecum in research facility texas united states of america mus musculus mouse 2017-04-07v4No1 / 13
386amnonhighfreq mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 14
494amnonhighfreq mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 14
326amnonhighfreq mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 15
405amnonhighfreq mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
494amnonhighfreq mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 15
212amnonhighfreq mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 17
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (highfreq mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 17
386amnonhighfreq mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 17
39amnonhigh freq. in obsese lepr-db mice (highfreq mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 18
216amnonhighfreq mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 19
503amnonhighfreq mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 19
457amnonhighfreq mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 20
476amnonhighfreq mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 20
124amnonhighfreq mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 21
503amnonhighfreq mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 21
248amnonhighfreq mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 22
334amnonhighfreq mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 22
108amnonhighfreq research facility, texas, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 25
46amnonsmj: higher in mice feces treated with antibiotics ( high in pulsed antibiotic treatment, macrolide tylosin tartrate antibiotic compared to control in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 28
47amnonsmj: lower in bullied immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america mus musculus male mouse strain c57bc/6ncrl research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 28
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in research facility texas united states of america colon mus musculus mouse )2017-04-07v4No1 / 31
14amnon high in caecum right colon transverse colon left colon feces compared to stomach duodenum jejunum ileum in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 51
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 58
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 58
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in mus musculus mouse feces united states of america )2017-04-14v4No1 / 63
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america mus musculus male mouse strain c57bc/6ncrl research facility no immunization: vehicle as control )2017-01-13v4No1 / 70
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 81
386amnoncommon mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 90
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
326amnoncommon mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 122
386amnonnegatively correlated with altitude (0-4km) in house mouse caecum ( high in low altitude compared to high altitude in mouse mus musculus caecum wild south america )2018-10-28v4No1 / 122
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 126
386amnoncommon mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 129
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 130
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 139
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 148
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 153
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 155
108amnoncommon research facility, texas, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 158
368amnoncommon feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 161
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 161
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 167
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 184
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 186
386amnoncommon mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 189
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 207
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 210
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 224
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
108amnoncommon research facility, texas, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
503amnoncommon mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 257
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 265
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 297
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 299
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 304
13amnon high in caecum colon rectum feces compared to esophagus stomach duodenum ileum mouth in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 316
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 407
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754

Problems / suggestions? Please email info AT dbbact DOT org